(PDF) ATP Synthase: Structure, Function and Inhibition

4 Pages758 Words40 Views

Added on 2021-01-02

(PDF) ATP Synthase: Structure, Function and Inhibition

Added on 2021-01-02

Related Documents

Module 6 Assessment

(PDF) ATP Synthase: Structure, Function and Inhibition_1

ATP SynthaseThe ATP synthase refers to an enzyme which creates energy storage molecule known asenergy adenosine triphosphate and it is mostly preferred by cells as an energy currency indifferent organism. The reaction catalysed by ATP Synthase is -ADP + Pi + H+out ATP + H⇌2O+H+inATP synthase has a couple of subunits including FOand F1 which ids considered asrotational motor mechanism for production of ATP (Lau and Rubinstein, 2012). Meanwhile,mitochondrial FOF1 ATP synthase is considered as an essential multi- subunit protein complexedin vast majority of eukaryotes but little is known about its composition and role of Trypanosomabrucei. Genes used in the studyTb10.70.7760 (TAP_Tb7760, RNAi_Tb7760); Tb927.5.2930 (TAP_Tb2930,RNAi_Tb2930); Tb927.5.1710 (TAP_subunit b); Tb927.3.1380 (TAP_subunit β);Tb927.7.7430/Tb927.7.7420 (RNAi_subunit α). SERIES OF EXPERIMENTSPlasmid construction – To create the vectors from T. brucei strain 427 genomic DNA byutilising several oligonucleotides which are given below:TAP_Tb7760 Fwd – ACAAAGCTTATGCAGGGCAGTTGGRev – ACAGGATCCAGCTGTGTGTCGGCCTAP_sub b Fwd – CACAAGCTTATGATGCGCCGTGRev – CACGGATCCCTCTACCTTTACATCTAP_Tb2930 Fwd – ACAAAGCTTATGCGCCGTGTATCRev – ACAGGATCCGTGATGGGCCTAP_sub β Fwd – ACAAAGCTTATGCTGACTCGTTTCCRev – ACAGGATCCGCTACTGGCTTGIn order to generate a construct of RNAi of Tb10.70.7760 and Tb927.5.2930 transcripts,fragments of 830bp & 646bp. The clones plasmid, pZJM via Xhol and HindIII restriction sites. RNAi_Tb7760 Fw – CACAAGCTTGAAGCTCAGGACCRev – CACCTCGAGGCAGAAACGCATCRNAi_Tb2930 Fw – ACAAAGCTTATGCGCCGTGTATCRev – CACCTCGAGTTCGGCCCGATC1

(PDF) ATP Synthase: Structure, Function and Inhibition_2

End of preview

Want to access all the pages? Upload your documents or become a member.