DNA Electrophoresis with Water

This article discusses the effects of using water instead of TAE or TBE in DNA electrophoresis. It explains why water is not recommended and how TAE and TBE protect DNA from hydrolysis and facilitate its movement in the gel. The article also provides insights into the pH and net charge of DNA in different buffers.

BIOL/MBIO 4230 Fall 2015 (100 points)
1. What would happen if you attempted to run DNA on an agarose gel
with water instead of TAE or TBE? Why would this be the case? (5
points)
The DNA will be prone to be hydrolyzed during the electrophoresis run.
TBE and TAE protect the DNA from electrophorectic hydrolysis.
Moreover, the DNA movement in the gel will be restricted during the
electrophoretic run. pI of DNA is around 5-6. The negative charge of
the DNA in high pH buffer of TAE and TBE (pH-8) results in
electrophoretic movement. In physiological water (pH 6-7) the net
charge of the DNA will be near to neutral to partially negative. The
movement of the DNA will therefore be hindered (Lee, Costumbrado,
Hsu, & Kim, 2012).
2. Answer the following questions:
a) Using a DNA sample that is 0.2 g/ul, set up a 20-l digestion
with Bam HI containing 1 ug DNA,10 units of
enzyme(10,000U/mL) and the appropriate buffer.(5 point)
COMPONENT 20 ul REACTION
DNA 5ul(1ug)
Bam HI 1ul (10 units)
10X NEBuffer 3.1 2ul (1X)
Nuclease-free Water 12ul
-
b) After digestion you want to stop the reaction by heat inactivating
the enzyme. Is this possible and if so at what temperature would
you do this?(5 points)
It is possible to heat inactivate the enzymes after digestion and this
can be achieved by incubating them at 65°C for 20 minutes. This
condition is enough to inactivate most of the restriction endonucleases
that have their acitivity at 37°C. Enzymes that donot get inactivated at
65°C are inactivated by incubating at 80°C for 20 minutes.

c) You also want to consider doing a double digestion with 10 units
of BamHI and 10 units of BciV1 (5,000U/mL). Set up a 20-l
digestion with Bam HI and BciV1containing 2 ug DNA(10 points)
There is no buffer in which both BamHI and BciVI exhibit >50% activity
and no star activity. A sequential digest will be necessary.
COMPONENT 20 ul REACTION
DNA 10ul(2ug)
Bam HI 1ul (10 units)
10X NEBuffer 3.1 2ul (1X)
Nuclease-free Water 7ul
Incubate at 37°C for 5–15 minutes as BamHI is Time-Saver qualified.
Purify the DNA from the first digestion and set up the second reaction
COMPONENT 20 ul REACTION
DNA 10ul(2ug)
BciV1 2ul (10 units)
10X CutSmart Buffer 2ul (1X)
Nuclease-free Water 6ul
Else we can use high fidelity Bam HI
COMPONENT 20 ul REACTION
DNA 10ul (2ug)
Bam HI HF 1ul (10 units)
BciV1 2ul (10 units)
10X CutSmart Buffer 2ul (1X)
Nuclease-free Water 5ul
3. Design a PCR program for amplification of a 1500-bp fragment from
a genomic DNA template. The forward and reverse primers have
calculated melting points of 57C and 58C, respectively. Name
each step, including any initial or final steps additional to
the 3 basic cycles. Do not give any procedures beyond listing the
PCR program. (10 points)
STEPS PROCESS TEMPERATUR
E
TIME
1 Start up 94 °C 10 mins

denaturation
2 Denaturatio
n
94 °C 30 sec
3 Anealing 55°C 20
sec
4 Extension 72°C 2 mins
Repeat steps 2 ,3 and 4 for 34 cycles
5 Final
extension
72 °C 7 min
6 Stop and
store
4 °C Till use
4. While doing a transformation of E. coli with a plasmid your
colleague learned that she was urgently needed at home. She
asked you to finish the process. She had just heat-shocked the cells
at 42°C and placed them on ice. Tell me the steps you would take
after this point to complete the transformation so that your friend
will be able to check on the results the next day.(5points)
1 ml of growth media will be added to the mixture. The mixture will be
kept for at 37°C for 1 hr in shaking conditions. The cells will be pelleted
down and after resuspending in 100ul of fresh growth media, it will be
spread on appropriate antibiotics containing LB agar plates for proper
selection.
5. Increasing the GC content of an oligonucleotide has the effect of (5
point)
a. increasing melting temperature
b. lowering melting temperature
c. increasing specificity for annealing to the template
d. decreasing specificity for annealing to the template

e. both a and c
On increasing the content of GC of an oligonucleotide, it’s melting
temperature and specificity for annealing to the template DNA will
increase. So the answer e is correct
6. You performed restriction digestion of the plasmid vector with a
unique restriction enzyme and ran a gel for the uncut plasmid mini
prep along with linearized plasmid vector. In the picture below,
indicate linear, supercoiled and nicked circular version of your
plasmid that is ~4kb in size.
Please write it in the provided white space below the band and
provide explanation. (5 points)
Supercoiled DNA
Migration of Supercoiled form of DNA is faster than anticipated speed
during DNA agarose gel electrophoresis due to its native conformation
as there is an extra twist into the double helical structure. During
plasmid preps, the superhelical tension resides due to the joined ends
of the plasmid.
Linear Plasmid
Linearized DNA results due to nick in both the strands of the plasmid at
the same place. Migration of Linear form of DNA is between the
supercoiled and nicked circular form. It migrates in accordance with
the molecular weight of the DNA of the marker.
Nicked Circular Plasmid
Nicked circular
Supercoiled Linear

Cellular topoisomerases nicks one strand of the Supercoiled DNA so as
to allow the recruitment of the polymerases to the DNA. The
conformation of the Nicked circle DNA is comparable to that of the
rubber band which does not have any extra twists introduced. This
Nicked circular form migrates slowest in an agarose gel.
7. You carried out gel purification of the plasmid and then you
restriction digested with EcoRI. Why was this necessary (what does
it accomplish)?(5 points)
This step is necessary to generate a linearly cut vector with an
overhang so that the gene of interest digested with the same enzyme
can be incubated with the vector for ligation.
8. What is the major purpose of the first step in the gel purification
process?
(5 points)
During the gel purification process, a specific buffer known as BINDING
BUFFER, containing an indicator of pH, is used to solubilize the gel cut
with the band of DNA. The sliced gel is heated with the buffer for
melting the gel. The pH indicator in the binding buffer ensures the
maintainance of the acidic pH required for proper binding of the DNA
with the silica membrane. If the pH in not acidic, as indicated by the
indicator then the pH can be adjusted so as to achieve acidic range for
proper binding of the DNA with silica membrane.
9. What are the advantages of In-Fusion cloning over traditional
cloning? Write the outline of steps (no need to give volume details) you
performed for In-Fusion cloning. (5 points)
In-Fusion Cloning enables directional, seamless cloning of any PCR
fragment into any linearized vector with high accuracy and high
fidelity. There is not any need of additional treatment of the PCR
fragment like restriction digestion, ligation, phosphorylation, or blunt
end treatment.
A plasmid vector and the cloning site within the vector were selected.
The vector was restriction digested to linearise and then purified to get
a digested vector. In accordance with the gene of interest, primers
with 15 bp extensions (5’) homologous to the linearized vector’s ends
were designed. Gene of interest was amplified with a DNA polymerase.
The target DNA that has been amplified was verified on an agarose gel
and the integrity of the PCR product was determined.
In-Fusion cloning reaction:

 5X In-Fusion Reaction Buffer
 In-Fusion Enzyme
 Vector
 Insert
 dH2 0 to a Total Reaction Volume of 10 μl was set up.
The mixture was kept at 37°C for 15 min, followed by incubation at
50°C for 15 min and then finally kept in ice. TE buffer (pH 8) was added
to make up the reaction volume to 50 μl and mixed well. Competent
cells were transformed with a small volume of the diluted reaction
mixture (Sleight & Sauro, 2013)
10. In a mini prep (plasmid isolation), after the cells have been
resuspended, what do the next two steps achieve and how? (5 points)
Lysis
After suspending the cells in resuspension buffer, the cells are lysed
using alkaline lysis method. The lysis buffer mainly contains Sodium
Dodecyl Sulfate (SDS) and sodium hydroxide (NaOH). This lysis buffer
is added to the resuspended cells. NaOH breaks the hydrogen bonding
of the DNA which results in the loss of double stranded structure. This
step converts the double-stranded DNA of plasmid as well as genomic
DNA into single stranded form of the DNA. The process of loss
hydrogen bonding of DNA is known as denaturation. It is the most
crucial step of the plasmid extraction, which attributes the name of the
method as alkaline lysis method. . SDS solubilizes the cell membrane
and denatures the proteins as well, which helps in separating the
proteins from the plasmid. During this step it is crucial to keep a check
on that the lysis buffer and the re-suspension buffer are mixed
properly but gently.
Neutralization
In this step potassium acetate is added which reduces the alkalinity of
the mixture which facilitates the re-formation of hydrogen bonding
within single stranded (ss) DNA to re-form the double stranded (ds)
DNA. So, during renaturation the small circular plasmid re-natures
easily but it is impossible for the genomic DNA to re-anneal properly.
That is why the lysis step should be gentle because the vigorous
mixing or vortexing will result in the shearing of the gDNA resulting in
small segments of the genomic DNA that can renaturel easily leading
to the contamination of the plasmid preparation.So after neutralisation
the re-annealed ds plasmid remains solubilised in the buffer, while the
ss gDNA along with the denatured cellular proteins form a white
precipitate. This precipitate is separated easily from the plasmid DNA
by spinning the mixture at a very high speed (Birnboim & Doly, 1979).

11. In general it is best not to add a volume of restriction enzyme to a
digestion that represents 25% or more of the total volume. Why not?
(5 points)
There are certain enzymes with low activity in salt containing buffers
(NEBuffer 3.1) and so these enzymes may be salt-sensitive. Using spin
columns for DNA purification procedures can result in high salt levels,
which can result in the inhibition of activity of enzyme. To prevent this
enzyme inhibition, the DNA solution volume added to the reaction for
these salt sensitive enzymes should be no more than 25% of total
reaction volume.
12. Unless we can dilute the template DNA for a PCR reaction why
would it not be stored in TE (Tris EDTA) buffer. [Why would we not
want to add DNA in TE to a PCR reaction](5 points)
EDTA of TE, if present in sufficient concentration can inhibit enzymatic
reactions like digestion, ligation, PCR. EDTA is metal chelator and thus
deactivates DNAse so it is preferred for long term storage of DNA.
Similarly EDTA can chelate metal that acts as co factor for the acitivity
of enzyme used in PCR, restriction digestion etc. then that enzyme
would be non functional. TE is a good choice to resuspending high-
concentration stock DNA as it will "protect" DNA long-term by buffering
and chelation, and then one can dilute high concentration TE stocks to
working concentrations with H2O later, simultaneously diluting EDTA
concentration.
13. Name the essential cofactor (normally present in the ligation
buffer) required for T4 DNA ligase activity. How does it help with the
ligase function? (5 Points)
Mg2+ and ATP are the co-factors required for the activity of T4 DNA
ligase and it is present in the ligation buffer.
The DNA ligase catalyses the formation of two covalent phosphodiester
bonds between 3'-OH group of one nucleotide ("acceptor"), with the 5'
PO-4 group of another ("donor") nucleotide. Two molecules of ATP are
utilised for formation of each phosphodiester bond.
Ligation involves three basic steps:

1. In the first step AMP is added (Addition of AMP is known as
Adenylation), to a lysine residue present in the active site of the
enzyme accompanied with the formation of pyrophosphate ;
2. In the next step AMP is transffered to the 5' PO-4 group of the
donor nucleotide resulting in the release of a pyrophosphate;
3. Last step comprises of the formation of a phosphodiester bond
between the 5' PO-4 group of the donor with the 3' –OH group of
the acceptor nucleotide.
14. Design a forward primer and reverse primer to amplify the
following p53 gene sequence.(5 points)
atggagg agccgcagtc agatcctagc gtcgagcccc ctctgagtca ggaaacattt
tcagacctat ggaaactact tcctgaaaac aacgttctgt cccccttgcc gtcccaagca
atggatgatt tgatgctgtc cccggacgat attgaacaat ggttcactga agacccaggt
ccagatgaag ctcccagaat gccagaggct gctccccgcg tggcccctgc accagcagct
cctacaccgg cggcccctgc accagccccc tcctggcccc tgtcatcttc tgtcccttcc
cagaaaacct accagggcag ctacggtttc cgtctgggct tcttgcattc tgggacagcc
aagtctgtga cttgcacgta ctcccctgcc ctcaacaaga tgttttgcca actggccaag
acctgccctg tgcagctgtg ggttgattcc acacccccgc ccggcacccg cgtccgcgcc
atggccatct acaagcagtc acagcacatg acggaggttg tgaggcgctg cccccaccat
gagcgctgct cagatagcga tggtctggcc cctcctcagc atcttatccg agtggaagga
aatttgcgtg tggagtattt ggatgacaga aacacttttc gacatagtgt ggtggtgccc
tatgagccgc ctgaggttgg ctctgactgt accaccatcc actacaacta catgtgtaac
agttcctgca tgggcggcat gaaccggagg cccatcctca ccatcatcac actggaagac
tccagtggta atctactggg acggaacagc tttgaggtgc atgtttgtgc ctgtcctggg
agagaccggc gcacagagga agagaatctc cgcaagaaag gggagcctca
ccacgagctg
cccccaggga gcactaagcg agcactgtcc aacaacacca gctcctctcc ccagccaaag
aagaaaccac tggatggaga atatttcacc cttcagatcc gtgggcgtga gcgcttcgag
atgttccgag agctgaatga ggccttggaa ctcaaggatg cccaggctgg gaaggagcca
ggggggagca gggctcactc cagccacctg aagtccaaaa agggtcagtc tacctcccgc
cataaaaaac tcatgttcaa gacagaaggg cctgactcag actga
Forward primer- 5’atggaggagccgcagtcagatc 3’
Reverse primer -5’ gtctgagtcaggcccttctgtc 3’
15. Write the steps (and purpose) done for Western blotting.(5 points)
Sample preparation
The sample is prepared from tissue or cells, or other sources of which
protein is to be quantified. The major role of this step is to isolate the

protein from the sample and then quantify it through protein
estimating methods. The protein is quantified to achieve even loading
in all the groups under study. Positive and negative controls are
selected in the study so as to prove the expression of the protein of
interest along with activity of the primary antibody. The samples the
mixed with gel loading dye which contains reducing agents like β-
mercaptoethanol and DTT and then subjected to heat for a brief period
of time. At this stage the proteins gets reduced and become negatively
charged which facilitates their movement through the gel.
Gel electrophoresis
Prepared samples are loaded into the polyacrylamide gel to separate
the proteins in accordance to their size by polyacrylamide gel
electrophoresis (PAGE). On applying the electric field, negatively
charged proteins move resulting in their separation in accordance with
their size.
Transfer to membrane
After PAGE the proteins are blotted to a solid membrane made up of
either of the following -nitrocellulose, polyvinylidene difluoride (PVDF),
and nylon. On applying the electric field the proteins (negatively
charged) from the gel gets blotted to the solid membrane.
Antibody probing
After transfer the membrane is blocked with any of the following-5%
Bovine Serum Albumin (BSA), dried non-fat milk diluted either in Tris
Buffered Saline (TBS) alone or with TWEEN (TBST), casein, fish gelatine
or normal goat serum with the intention of blocking non-specific
binding of the antibodies to the membrane. The membrane blocking is
done for an hour or longer at room temperature or at 4°C for long
incubation periods. After blocking the membrane is probed with the
primary antibody of the protein under study preferably overnight at
4°C. After this the membrane is washed and probed with the
secondary antibody in accordance with the primary antibody. This step
is done for near about an hour at room temperature. The secondary
antibody is tagged with a detection antibody.
Detection
HRP along with chemiluminescent substances, is the most common
detection agent for western blotting. Luminol peroxide in the detection

reagent is oxidised with HRP to emit light which is captured by the
camera (Kurien & Scofield, 2006).
16. What was the purpose of performing the BCIP test on the E. coli
cells grown on High Phosphate and No Phosphate media? (5 points)
BCIP (5-bromo-4-chloro-3-indolyl phosphate) test quantifies presence
of acid phosphatase to give blue or aqua color. If there is no phosphate
BCIP test will give no color. The principle of executing the BCIP test on
the E. coli cells grown in the presence and absence of the phosphate
media is that in the presence of high phosphate the cell will produces
phosphatase which on reacting with BCIP reagent will give blue color
and in absence of phosphate there would be no phosphatase and thus
no color.
References:
Birnboim, H. C., & Doly, J. (1979). A rapid alkaline extraction procedure for screening
recombinant plasmid DNA. Nucleic Acids Res, 7(6), 1513-1523.
doi:10.1093/nar/7.6.1513
Kurien, B. T., & Scofield, R. H. (2006). Western blotting. Methods, 38(4), 283-293.
doi:S1046-2023(06)00006-5 [pii]10.1016/j.ymeth.2005.11.007
Lee, P. Y., Costumbrado, J., Hsu, C. Y., & Kim, Y. H. (2012). Agarose gel
electrophoresis for the separation of DNA fragments. J Vis Exp(62). doi:3923
[pii]10.3791/3923
Sleight, S. C., & Sauro, H. M. (2013). BioBrick assembly using the In-Fusion PCR
Cloning Kit. Methods Mol Biol, 1073, 19-30. doi:10.1007/978-1-62703-625-2_3