University Biochemistry Report: Key Concepts in Health Science

This biochemistry report is divided into three parts. Part A defines pyrimidines and their role, compares ethanol and ethanal, and contrasts stearic and oleic acid, along with the synthesis of butyl ethanoate. Part B explores the cell membrane structure, emphasizing the roles of lipids, proteins, and carbohydrates. It covers the fluid mosaic model and the function of membrane proteins, glycoproteins, and glycolipids. Part C discusses penicillin's mechanism of action, analyzes mRNA and amino acid sequences, and compares normal and sickle cell hemoglobin. The report also identifies key components of DNA and RNA and presents species comparisons based on amino acid sequences.

Running Head: KEY CONCEPTS IN BIOCHEMISTRY
Key Concepts in Biochemistry
Name of the student:
Name of the University:
Author Note:

1KEY CONCEPTS IN BIOCHEMISTRY
Part A
1. Pyrimidine is a class of heterocyclic nitrogenous bases that forms a six membered
diazine ring which has nitrogen placed in the 1st and the 3rd position.
Fig1: Pyrimidine (Cafferty & Hud, 2015)
Pyrimidine found in DNA are cytosine and thymine and in RNA uracil is replaced by
thymine. It plays an important function in human metabolism by formation of
ribonucleotide and deoxyribonucleotide bases (Cafferty & Hud, 2015).
2. Ethanol is an alcohol molecule which have a lone pair of electrons, the hydrogen atom
which have a partial positive charge binds to an oxygen molecule and forms hydrogen
bonds. Ethanal is an aldehyde molecule which has the partially positive carbon atom
that bonds with oxygen having a partially negative charge, C=O, to form a permanent
dipole-dipole bond. Hydrogen bonds are strong and requires more energy to break in
comparison to dipole-dipole bonds. Hence, ethanol has a higher boiling point.
3. Stearic acid and oleic acid are C18 long chain fatty acids but the difference between
them is that stearic acid is saturated and oleic acid is unsaturated. Melting point is
directly proportional to molecular weight and inversely proportional to level of
saturation (Yuan et al., 2014). Oleic acid has a carbon-carbon double bond, C=C
hence, it has a melting point lower than stearic acid.
4. Butyl ethanoate also known as n-Butyl acetate is an ester. Ester is an important
functional group. The hydroxyl (O-H) group of the acids is replaced by the alkoxy (O-
R) group. It is synthesized by Fischer Esterification Reaction (Eleuterio et al., 2015).
It is formed by condensation of the butanol with the acetic acid in the presence of

2KEY CONCEPTS IN BIOCHEMISTRY
sulphuric acid that acts as a catalyst. The reactants of the reaction are acetic acid and
butanol.
Fig 2: Butyl Ethanoate Synthesis (Eleuterio et al., 2015)
Part B
Human body requires nutritional energy from carbohydrates, proteins and lipids for
growth, maintenance and activity. The effective supply of energy from the different food
supplements vary, carbohydrates are the earliest in releasing energy and fats or lipids are
comparatively slow. Proteins are the building block of the body. These carbohydrates,
proteins and lipids are very essential for our body and are involved in all the vital activities of
the body but in this article the functions of these nutrients with respect to the cell membrane
structure is discussed.
Lipids are the main structural component of the cell membrane. The semipermeable nature
of the cell membrane is imparted by the lipid bilayer formed. The membrane consists of a
phospholipid bilayer which has a hydrophobic tail and a hydrophilic head (Rothfield, 2014).
A phospholipid is a triglyceride molecule in which the fatty acid chain in substituted by a
phosphate group (Holthuis & Menon, 2014). The lipid bilayer has the hydrophilic head on the
outer side facing the extracellular components and the hydrophobic tail is in the inner side
facing the intracellular components of the cell (Ingólfsson, et al., 2014). The hydrophobic
fatty acid tail permeates fat soluble molecules like oxygen whereas it prevents the entry of
larger water-soluble molecules like sugar molecules and some charged ions as well.
The essential contribution of proteins in the cell membrane include preventing the entry of
toxic substances inside the cell, they form specialised channels in the cell membrane that
allows selective entry of ions, nutrients and metabolic products and ensures exit of waste
products. They separate essential but incompatible metabolic processes that occur in
organelles. The proteins embedded in the membrane can be essentially classified into integral
membrane proteins and peripheral membrane proteins (Laganowsky et al, 2014). The

3KEY CONCEPTS IN BIOCHEMISTRY
integrated membrane proteins span the entire membrane and are permanently anchored to the
membrane. The peripheral proteins are present on the periphery of the membrane and are not
permanently anchored on the membrane. The plasma membrane contains 50% of proteins.
Membrane proteins serve as ion channels, transporters, GPCR (G Protein Coupled
Receptor) and membrane proteins. The membrane receptor proteins transmit extracellular and
intracellular signals (Hughes, 2014). The transporter proteins span around the membrane
entirely and allow the passage of macromolecules, micro molecules and ions to pass through
the membrane. Ion channels are one in all most vital kind of membrane transport proteins.
The functions of ion channel embrace institution of a resting membrane potential which helps
in maintaining action potentials and various electrical signals by permitting the flow of ions
across the plasma membrane, dominant the flow of ions across liquid body substance and
animal tissue cells, and regulation cell volume. Some enzymes are membranes proteins, they
include, oxidases and hydrolase. Cell adhesion molecules that are placed on the cell surface
concerned in binding with different cells or with the extracellular matrix (ECM), permit cells
to spot one another and move (Cymer, Von & White, 2015). These mainly includes the
immunoglobulins present on the membrane surface. They help in the immune response of the
body. These immunoglobulins make membrane proteins a potential interest in the field of
biotechnology and pharmacy. The figure below represents the types of membrane proteins in
the cell membrane.
Carbohydrates contain sugar molecules that when linked to proteins in the cell membrane
form glycoproteins and proteoglycans, when carbohydrates are linked to lipid molecules, they
form glycolipid (Sprovieri & Martino, 2018). Cells have a rich layer of carbohydrates on the
cell surface known as glycocalyx. The carbohydrates play an important role in cell-cell
recognition which is the ability of the membrane to distinguish between the different types of
neighbouring cells based on the ligand present on the cell surfaces. Glycosylation reactions
causes linking of the glycosyl group of a carbohydrate with the hydroxyl group of other
molecules like lipids and proteins. This results in formation of glycolipids and glycoproteins.
In glycoproteins, glycosyl groups can be O-linked and N-linked. N-linked glycosylation are
more predominant and imparts cell adhesion property to the membrane and helps in
adherence of the cell to the extracellular matrix. Glycolipids play an important role in
immune response. The four human blood types A, B, AB, O are glycolipids on the cell
surface. The oligosaccharides linked to the glycolipid on the red blood cells acts as the

4KEY CONCEPTS IN BIOCHEMISTRY
antigen. Glycolipids are recognition sites that take part in cell-cell recognition. They bind to
carbohydrate binding macromolecules called lectin (Harrison, 2013).
The cell membrane that surrounds the components of the cell consists of a phospholipid
bilayer. The characteristic of the cell membrane is explained by the help of Fluid Mosaic
Model. The figure above gives a vivid idea about the cell membrane structure. At body
temperature it exhibits fluid nature, immiscible in water. Proteins are embedded in this
membrane in the form of mosaic and hence the name Fluid Mosaic Model (Nicolson, 2013).
The proteins create the channels that allows selective passage of those substances into and out
of the cell, additionally it helps forming the bottom for the receptors. The carbohydrates are
linked to proteins and they create the receptor together.
Part C
1) Penicillin is a group of antibiotics that consists of the β lactam ring that imparts the
antimicrobial property to penicillin. Penicillin binds to penicillin binding proteins (PBPs)
and intervenes in the peptidoglycan formation in cell wall synthesis. Penicillin acts in the
final transpeptidation step of penicillin formation, it mimics the substrate of
transpeptidase enzyme, acyl-D-alanyl-D-alanine. Penicillin binds to other PBPs like
murein hydrolases which is an inhibitor of autolysis. This promotes lysis of bacterial cell.
2) Transcribed mRNA of the DNA sequence 1 is:
5’-AUUUUAGUCGAGAUCUGCCAUG-AGA-UGAUCAGUACCAGGUAG-3’
Translated protein strand from the mRNA is: M-R
The UAG and UGA are the stop codons and AUG is the start codon as well as codes for
methionine and the next codon is for arginine.
Transcribed mRNA of the DNA sequence 2 is:
5’-GCCCCCGCCAUCAGGAGUUGGAUCACCCACACC-3’
The mRNA sequence transcribed has no start codon in it. Therefore, no amino acid can be
translated from the mRNA sequence.
3) The mRNA and amino acid sequence for both normal and sickle cell haemoglobin is
given below:
mRNA sequence of normal haemoglobin: GTGCACCTGACTCCTGAGGAGAAG

5KEY CONCEPTS IN BIOCHEMISTRY
Amino acid sequence of normal haemoglobin is Val-His-Leu-Thr-Pro-Glu-Glu-Lys
mRNA sequence of sickle cell haemoglobin: GTGCACCTGACTCCTGTGGAGAAG
Amino acid sequence of normal haemoglobin is Val-His-Leu-Thr-Pro-Val-Glu-Lys
The sickle cell anaemia is caused by a single code change in the DNA sequence.
Adenine (A) is replaced by Threonine. This results in change in the amino acid, valine
(Val) replaces glutamine (Glu). The presence of valine makes the haemoglobin long,
fibrous and they tend to adhere together. This causes distortion in the shape of red blood
cells. Hence, these distorted RBCs are unable to carry adequate amount of oxygen and
often blocks blood flow in small blood vessels.
4) a. Guanine is present in both DNA and RNA.
b. Adenine is present in both DNA and RNA.
c. Cytosine is present in both DNA and RNA.
d. 2-deoxy-D-ribose is present in DNA.
e. D-ribose is present RNA.
f. Uracil is present RNA.
5) The closely related ones are placed in the first 4 rows and distant ones in the next 2.
1 Human DVEKGKKIFIM
2 Rhesus monkey DVEKGKKIFIM
3 Bullfrog DVEKGKKIFVQ
4 Chicken DIEKGKKIFVQ
5 Tuna DVAKGKKTFVQ
6 Silkworm moth NAENGKKIFVQ
The ranking gives a definite information on the interrelation of the species. This is
because rhesus monkey shows most similarity with the human genome (Marks, 2017).
6) a. The coding strand is 5'-ATGTACGCTACTTGA-3' and the template stand is 3'-
TACATGCGATGAACT-5'
b. The mRNA sequence obtained from transcription of the given DNA template strand is
3’-AUGUACGCUACUUGA-5’
c. The anticodons of tRNA required for translation of the given mRNA codons is
UACAUGCGAUGAACU.

6KEY CONCEPTS IN BIOCHEMISTRY
d. The amino acid sequence obtained upon translation of the given mRNA is Methionine-
Tyrosine-Alanine-Threonine (Met-Tyr-Ala-Thr).
References
Sprovieri, P., & Martino, G. (2018). The Role of the Carbohydrates in Plasmatic
Membrane. Physiological research, 67(1), 1-11.
Rothfield, L. I. (Ed.). (2014). Structure and function of biological membranes. Academic
press.
Ingólfsson, H. I., Melo, M. N., Van Eerden, F. J., Arnarez, C., Lopez, C. A., Wassenaar, T.
A., ... & Marrink, S. J. (2014). Lipid organization of the plasma membrane. Journal of
the american chemical society, 136(41), 14554-14559.
Holthuis, J. C., & Menon, A. K. (2014). Lipid landscapes and pipelines in membrane
homeostasis. Nature, 510(7503), 48.
Laganowsky, A., Reading, E., Allison, T. M., Ulmschneider, M. B., Degiacomi, M. T.,
Baldwin, A. J., & Robinson, C. V. (2014). Membrane proteins bind lipids selectively to
modulate their structure and function. Nature, 510(7503), 172.
Hughes, R. C. (2014). Membrane glycoproteins: a review of structure and function. Elsevier.
Cymer, F., Von Heijne, G., & White, S. H. (2015). Mechanisms of integral membrane protein
insertion and folding. Journal of molecular biology, 427(5), 999-1022.
Harrison, R. (Ed.). (2013). Biological membranes: their structure and function. Springer
Science & Business Media.
Nicolson, G. L. (2013). Update of the 1972 Singer-Nicolson fluid-mosaic model of
membrane structure. Discoveries, 1(1), e3.
Cafferty, B. J., & Hud, N. V. (2015). Was a Pyrimidine‐Pyrimidine Base Pair the Ancestor of
Watson‐Crick Base Pairs? Insights from a Systematic Approach to the Origin of
RNA. Israel Journal of Chemistry, 55(8), 891-905.
Yuan, Y., Zhang, N., Tao, W., Cao, X., & He, Y. (2014). Fatty acids as phase change
materials: a review. Renewable and Sustainable Energy Reviews, 29, 482-498.

7KEY CONCEPTS IN BIOCHEMISTRY
Eleuterio dos Santos, C. M., Pietrowski, G. D. A. M., Braga, C. M., Rossi, M. J., Ninow, J.,
Machado dos Santos, T. P., ... & Nogueira, A. (2015). Apple amino acid profile and
yeast strains in the formation of fusel alcohols and esters in cider production. Journal
of food science, 80(6), C1170-C1177.
Marks, J. (2017). Human biodiversity: Genes, race, and history. Routledge.