Insect Cell Lines for Dengue Receptor Prohibitin-2 Knockout: Report

This report details a project focused on creating and characterizing insect cell lines for the genetic knockout of the putative dengue receptor, prohibitin-2, using molecular and cellular methods. The study, part of a larger project, involved utilizing CRISPR/Cas9 technology to target the prohibitin-2 gene in Aedes albopictus mosquito-derived C6/36 cells. The researchers developed and analyzed two cell lines, Odd3 and 4G5, derived from the parent C6/36 cells. The work included DNA extraction, PCR amplification, gel electrophoresis, and DNA sequencing to identify and characterize indels resulting from the CRISPR/Cas9-mediated gene editing. The Odd3 cell line was successfully modified to achieve mono-allelic and then bi-allelic knockout of prohibitin-2. The 4G5 cell line showed in-frame deletions, which did not disrupt prohibitin-2 function. The study aims to understand the interaction between the dengue virus and its host, potentially controlling disease transmission by targeting the Aedes mosquito vector. This project builds on the previous research where Prohibitin-2 was identified as a receptor for dengue virus serotype-2 in insect cell lines.

Running head: Paraphrase
paraphrase
[Document subtitle]
[DATE]
[Company name]
[Company address]

Paraphrase 1
Abstract:
Dengue is a mosquito-borne viral illness. Dengue occurrence has expanded more than 30-fold in
late decades because of the topographical extension of the Aedes vector mosquitoes and dengue
infections. Hence, vector control is a central way to deal with lessen sickness transmission and
spread. Recognizable proof of dengue receptors is critical in understanding Dengue life cycle at
that point control the contamination transmission. A putative dengue infection receptor,
Prohibitin-2, has been effectively thumped out in C6/36 cell line got from mosquitos. A creepy
crawly vector has been utilized to express a sgRNA correlative to Prohibitin-2 quality of Aedes
albopictus mosquito utilizing CRISPR/Cas9 vector. At that point the DNA plasmid has been
transfected into a C6/36 cell line. In this way, C6/36 cells with a knockout in Prohibitin-2 is
chosen, extended, and Grown in cell culture to consider the dengue infection have connection
among single cells.This undertaking reason for this project is to made and portrayed insect cell
lines for hereditary knockout of the putative dengue receptor, prohibitin-2 utilizing sub-atomic
and cell methods. We described cell populace of two unmistakable cell lines, Odd3 and 4G5 cell
lines, got from parent C6/36 cell. The characterisation closed accomplishing mono-allelic
knockdown in Odd3 cell line. In this manner, Odd3 is re-altered utilizing CRISPR/Cas9 to
accomplish transformation on the other allele. The characterisation of cells got from Odd3 cell
line after re-altering, Odd3-4E4 and Odd3-1C3 proposed holding the allelic transformation in
Odd3 cells. Then again, 4G5 cell line characterisation uncovered legacy of in-outline
cancellations of 24 amino acids that don't cause loss of prohibition 2 function.

Paraphrase 2
Aims and objectives:
Prohibitin is recognized and portrayed as a receptor, and communicating protein interceded
Dengue infection serotype-2 section (Kuadkitkan et al., 2010). The examination used insect cell
line got from Aedes mosquitoes. Utilizing VOPBA examination, Prohibitin, monitored and
communicated in most by far of eukaryotic cells, was distinguished when isolated with
powerlessness to disease. Co-immunoprecipitation exhibited the cooperation between Dengue
infection and Prohibitin. Besides, the part of Prohibitin in insect cell passage was affirmed by
small interfering RNA (siRNA), and immune response interceded disease restraint and in
addition colocalization of the infection and protein on the cell surface. The characterisation of
the association was just with dengue infection serotype-2. Consequently, there is a plausibility of
collaborating with other dengue serotypes.
Along these lines, we are planning to distinguish and describe prohibitin-2 as a receptor for the
dengue infection in insect cell by means of a few stringent sub-atomic and cell methods.
Utilizing CRISPR/Cas9, Dr Shiu-Wan has had point out the prohibitin-2 quality to consider the
dengue infection virus host interaction. Additionally, we are meaning to demonstrate that the
Prohibition-2 quality can be quieted utilizing CRISPR/Cas9 genome control apparatus which
influences the practical part of Prohibition-2 quality. Prohibiting 2 wild sort must change over to
bi-allelic transformation to accomplish fruitful quality capacity quieting. A fruitful Prohibition-2
quality hushing is basic in control the spreading and transmission of DENV by controlling the
vector, Aedes mosquitoes.
This undertaking is a piece of the fundamental project began by Dr Shiu-Wan. An insect vector
has been utilized to express a sgRNA corresponding to Prohibitin-2 quality of Aedes albopictus

Paraphrase 3
mosquito utilizing CRISPR/Cas9 vector. At that point the DNA plasmid has been transfected
into a C6/36 cell line. Hence, C6/36 cells with a hit in Prohibitin-2 is chosen by restricted
weakening, extended, and Grown in cell culture to consider the dengue infection have
communication among single cells. Thus, the destinations of this venture are to make and keep
up cell lines got from C6/36 that already thumped out, and describe these cells populaces for
hereditary knockout of the putative dengue receptor, prohibitin-2. After cell culture, DNA is
removed, opened up by PCR, and keep running on gel electrophoresis to distinguish INDELS
that will be affirmed by DNA sequencing.
Study design and methodology:
Study Design:
This task had been begun by Dr Shiu-Wan Chan before we began, and we took part in the
recognizable proof and characterisation utilizing cell and sub-atomic systems. To give an outline
of undertaking work process (Figure 4), the examination configuration is portrayed in three
sections: the part done by DR Shiu-Wan Chan, that part done by Master understudies, and future
recommendations. The initial segment incorporates the accompanying strategies and techniques:
To start with, the cloning of sgRNA into plasmid vectors (E. coli). The vectors encode the
Puromycin protection quality (as a selectable marker to demonstrate the accomplishment of a
transfection), cas9. Furthermore, transfection of the plasmid vector by utilizing a lipid. The cells
proceed to develop and entry keeping up determination weight by keeping puromycin in the
development medium (with and without puromycin). Following 1-2 weeks, countless cells were
executed by the puromycin, demonstrating that they didn't take up or had lost the plasmid with
the puromycin protection quality. The cells that stayed developing in the puromycin-containing

Paraphrase 4
medium had held the articulation plasmid, which may have steadily incorporated into the
genome of the focused on cells.
The third stage is clonal choice: Select clonal populaces of cells by exchanging an all around
secluded single cluster of cells (the clonal precursor and cells got from it) into a well in a 24 well
plate; rehash to choose 5-10 clonal populaces. Fourth, recognize a solitary clone through
constrained weakening and extension. Restricted weakening has been utilized with cells both
with and without puromycin determination to seclude every cell that conveys INDELS by
putting them at low cell densities (<1 cell per well in 96 well plates), and growing provinces
from those single cells in partitioned wells (24 wells then six wells plate).
Mono-allelic knockout cells have been made (second era). A moment CRISPR knockout has
been performed on these mono-allelic knockout cells to make bi-allelic knockout. This venture is
to screen the cloned cells, which are third era cells, utilizing cell and atomic systems, including
cell culture, DNA lysate and extraction, PCR, and gel electrophoresis and in addition DNA
sequencing for the bi-allelic knockout. The last piece of the examination relies upon the
achievement of the second part, which utilizes systems, for example, western smear and
immunofluorescence measure to affirm the quality hushing and additionally to demonstrate the
theory.
Materials and methods:
1. Cell Culture
C6/36 is the parental cell line, which was gotten from larvae of the Asian tiger mosquito,
Aedes albopictus. The clones 4G5 and Odd3are got from C6/36.These cells were

Paraphrase 5
confined clonal cells in 96 wells, where we kept the cell development and exchanged the
70-90% confluent cells from a 96 well plate to 24 well plate at that point to 6 well plate.
Cells were kept under particular cell culture conditions at 28°C, 5% CO2. The cell line
was kept up and developed in Minimum Essential Medium Eagle (MEM) with Earle's
salts, 2 Mm L-glutamine, sodium bicarbonate (SIGMA); 10 % Fetal Bovine Serum (FBS)
(SIGMA-ALDRICH); MEM Non-Essential Amino Acids Solution (SIGMA-ALDRICH);
2 % Penicillin-Streptomycin arrangement (SIGMA-ALDRICH).
8.2.2. Extraction of nucleic acids
Examples were centrifuged for a moment to dispose of the supernatant, the development
medium. At that point, the pallet was washed with phosphate cushioned saline (PBS). DNA was
extricated from refined cells with PureLink® Genomic DNA Kits (Invitrogen) as indicated by
the manufacturer's guidelines; the cell was lysate utilizing Proteinase K, RNase A, 96-100%
ethanol and PureLink® Genomic Lysis/Binding Buffer (Invitrogen) as indicated by the
producer's details. DNA was washed with PureLink® Genomic Wash Buffers 1 and 2 by
utilizing PureLink® Spin Columns in Collection Tubes as indicated by the maker's details. DNA
was eluted utilizing sterile water.
8.2.3. DNA Quantitation
DNA Quantitation was done utilizing a Thermo Scientific™ NanoDrop™, ND-1000
spectrophotometer instrument. DNA absorbance was measured at 260 nm.
8.2.4. DNA amplification by Polymerase Chain Reaction (PCR)

Paraphrase 6
PCR Mix was set up to contain the accompanying: 2 μl Taq support (1X Standard Taq cushion
contains 10 mM Tris-HCl, 50 mM KCl, and 1.5 mM MgCl2, pH 8.3) , 0,4 μl of 10 mM
deoxyribonucleoside triphosphate (dATP, dCTP, dGTP, dTTP), 0,4 μl of 10 μM IR, 0,4 μl of 10
μM IF , 1 μg of DNA, and 0,1 μl of Taq polymerase (New England Bio-Labs®) in a last
response volume 20 μl of DNA. The cycle conditions for PCR were 94°C for 2 min, trailed by 30
cycles of 94°C for 25 seconds, 54°C for 35 seconds, and 68°C for 1 minutes, and afterward 68°C
for 7 minutes.
8.2.5. Detection of nucleic acids by Gel Electrophoresis
Nucleic acids were keep running on a 3 % agarose gel that was set up with ethidium bromide and
1x Tris-acetic acid derivation EDTA (TAE) support. Electrophoresis was performed with 100
volts for 1 hour and 45 minutes.
8.2.6. DNA SEQUENCING
PCR items were cleaned up utilizing CleanSweep™ PCR Purification Kits by Invitrogen™ for
sequencing. 6.4 μl DNA was blended with 2.6 μl decisive victory (Invitrogen™). At that point, it
was hatched at 37°C for 15 and 80°C for 15 minutes individually. Next, 1 μl of 4 μM IF
(atattccggcgcggtgattg) was included Sanger sequencing was done in the DNA SEQUENCING
office at The University of Manchester, Stopford Building.
8.2.7. Data analysis
Chromas apparatus is utilized to see the successions in chromatogram frame. Following of Indels
by DEcomposition (TIDE) is web apparatus used to evaluate CRISPR-Cas9 genome altering
(https://tide-calculator.nki.nl/); measured the viability of altering, and recognized of Indels.
CRISPR-ID is an application used to distinguish CRISPR indels in Sanger succession

Paraphrase 7
(http://crispid.gbiomed.kuleuven.be/). Clustal Omega is a device used to create numerous
grouping arrangements (http://www.ebi.ac.uk/Tools/msa/clustalo/). ExPASy is interpretation
devices used to decipher nucleotides (http://web.expasy.org/decipher/).
10. Discussion
In this particular study , we have described cell populace of two different cell lines, Odd3 and
4G5 cell lines, got from parent C6/36 cell for knockout of the putative dengue infection receptor,
prohibition 2. Featuring what Kuadkitkan et al. (2010) have done which they recognized
Prohibitin as a receptor for dengue infection sort 2 in insect cell line. Not at all like their
investigation, we knocked out Prohibitin-2 utilizing CRISPR/Cas9 while they thumped out
Prohibitin utilizing siRNA that have less reliable knockdown and less quality hindrance when
contrasted with CRISPR/Cas9 (Boettcher and McManus, 2015). The characterisation closed
accomplishing mono-allelic knockout in Odd3 cell line. In this manner, Odd3 is re-altered
utilizing CRISPR/Cas9 to accomplish change on the other allele. The characterisation of cells got
from Odd3 cell line after re-release, Odd3-4E4 and Odd3-1C3 proposed holding Odd3 allelic
transformation. Then again, 4G5 cell line characterisation uncovered legacy of in-outline
erasures of 24 amino acids that don't cause loss of prohibition 2 articulation. In like manner,
CRISPR tool has been utilized by Marceau et al., (2016) to distinguished multi-protein buildings
related with Endoplasmic-reticulum and associated with Dengue infection replication.
Subsequently, we recommend the likelihood of accomplishing fruitful biallelic knockout in
advance altering.
Presentation of Cas9 and sgRNA incited a scope of inclusions as well as erasures (indels). Little
indels created by cleavages are too little to distinguish effectively utilizing agarose gel (Zhang

Paraphrase 8
and Reed 2017). Accordingly, Sequencing of PCR results of Odd3-4E4 indicated mono-allelic
transformation with inclusions of 5 nucleotides, holding the Odd3 mono-allelic changes.
Interestingly, Odd3-1C3 Showed cancellation of 4 bp. Despite what might be expected, 4G5 cell
line that got from C6/36 cells were sequenced which uncovered two free deletions, an evacuation
of 22 and 24 bp. The 22 bp deletions demonstrated frameshift change, while 24 bp cancellations
appeared in-outline cancellations. The 24 bp cancellations cause erased of 8 codons keeping the
perusing outline in a similar arrangement, which does not cause loss of restriction 2 articulation
and losing of the capacity relies upon whether the eight amino acids are fundamental for work.
Likewise, there is a probability to knock out quality capacity by presenting substantial
cancellations by encourage CRISPR altering, for instance, Zhang et al. (2015) could utilize
CRISPR/Cas9 to create extensive erasure and down-directed Hox qualities in insect cells.
This study is a piece of a noteworthy undertaking intended to distinguished and described of a
putative dengue infection receptor, Prohibition-2, in insect cells. As a piece of this undertaking,
we have depicted the knocked out-cells by Dr Shiu-Wan. The characterisation recognized the
nearness of mono-allelic knockout. These outcomes are promising and show the likelihood of
accomplishing effective bi-allelic knockout when re-altering cells once more. Because of the
constrained time of this undertaking, couple of cells were described. Additionally, the diploid
cells require knockout of every haploid to accomplish a bi-allelic knockout. Also, this requires
more opportunity to perform. In this manner, we recommended doing re-altering to cells that
accomplished a monoallelic knockout and describe the aggregate populace that may have the
biallelic transformation.
In the event of getting of a fruitful bi-allelic knockout, a few strategies are utilized to affirm the
prohibitin-2 protein as a putative receptor engaged with Dengue infection section of the insect

Paraphrase 9
cell. The strategies may incorporate Western blotching, infection overlay protein restricting
measure, immunofluorescence, or Antibody interceded disease restraint test (Hai et al., 2014;
Kuadkitkan et al., 2010; Salas-Benito and Del Angel, 1997). Prohibitin-2 is universal and
rationed protein with different parts and capacities, yet the whole capacity is still just in part
comprehended (Mishra et al., 2006). Prohibitin is the primary distinguished and portrayed
receptor communicated in bug cell (Kuadkitkan et al., 2010). Likewise, examine above depicted
the association with just dengue infection serotype-2. Subsequently, there is a probability of
interfacing with other dengue serotypes. Additionally, Prohibitin knew as rationed and pervasive
protein (Mishra, Murphy and Murphy, 2006). Consequently, it likewise possibly interfaces with
dengue infection in mammalian cells. Consequently, we likewise recommend recognizing
Prohibitin as a putative receptor in mammalian cells.
The recognizable proof of Prohibition-2 as a receptor for dengue receptor will meddle the
infection life cycle. Additionally, a fruitful Prohibition-2 knockout is basic in control the
spreading and transmission of dengue infection by vector populace concealment. Hereditary
methodologies for controlling dengue vectors have pointed either to diminish wild-sort
populaces or to supplant wild-sort populaces with mosquitoes that can't transmit dengue
infection (Robert et al., 2013). We additionally can make transgenic mosquitoes conveying
antipathogen effector qualities focusing on passage of dengue infection to cells which this
quality gives protection from the transmission of the dengue (Gantz et al., 2015). Moreover,
Gene drives utilizing CRISPR/Cas9 uncover a system for the development of safe allele and
proficiency of quality drives. For example, a working quality drive could be quickly dispersed
among a whole populace to control mosquitoes-borne illnesses, for example, jungle fever
(Champer et al., 2017). When we recognized Prohibitin-2 as DENV receptor in mosquitoes, we

Paraphrase 10
can focus on the dengue vector mosquitoes through a CRISPR/Cas9 quality drive framework.
The improvement of quality drives will stifle Aedes mosquito populaces to a level which don't
bolster dengue transmission. A comparable idea is accomplished by Hammond et al. (2016) in
intestinal sickness mosquito vector Anopheles gambiae recommending the accomplishment of
quality driving innovation.