Characterization of Dengue Receptor Knockout Insect Cell Lines

This project, conducted by a student and available on Desklib, focuses on creating and characterizing insect cell lines for the genetic knockout of the putative dengue virus receptor, Prohibitin-2. The study utilizes CRISPR/Cas9 technology to target the Prohibitin-2 gene in C6/36 cell lines derived from Aedes albopictus mosquitoes. The project involves cell culture, DNA extraction, PCR amplification, gel electrophoresis, and DNA sequencing to identify and characterize cells with successful gene knockouts. The research aims to understand the dengue virus-host interaction and potentially control the spread of the virus by targeting the Aedes mosquito vector. The project details the methodology, including clonal selection, limited dilution, and re-editing of cell lines to achieve bi-allelic knockout. Characterization of cell populations, including Odd3 and 4G5 cell lines, revealed mono-allelic knockout and in-frame deletions. The ultimate goal is to silence the Prohibitin-2 gene and study its impact on dengue virus entry and replication, contributing to the broader understanding of dengue virus biology and potential control strategies.

Abstract
Dengue is a mosquito-borne viral disease. Dengue incidence has increased more than 30-fold in recent decades due
to the geographical expansion of the Aedes vector mosquitoes and dengue viruses. Thus, vector control is a
fundamental approach to reduce disease transmission and spread. Identification of dengue receptors is critical in
understanding Dengue life cycle then control the infection transmission. A putative dengue virus receptor,
Prohibitin-2, has been successfully knocked out in C6/36 cell line derived from mosquitos. An insect vector has been
used to express a sgRNA complementary to Prohibitin-2 gene of Aedes albopictus mosquito using CRISPR/Cas9
vector. Then the DNA plasmid has been transfected into a C6/36 cell line. Therefore, C6/36 cells with a knockout in
Prohibitin-2 is selected, expanded, and Grown in cell culture to study the dengue virus-host interaction among single
cells. This project purpose is to created and characterised insect cell lines for genetic knockout of the putative
dengue receptor, prohibitin-2 using molecular and cellular techniques. We characterised cell population of two
distinct cell lines, Odd3 and 4G5 cell lines, derived from parent C6/36 cell. The characterisation concluded achieving
mono-allelic knockdown in Odd3 cell line. Thus, Odd3 is re-edited using CRISPR/Cas9 to achieve mutation on the
other allele. The characterisation of cells derived from Odd3 cell line after re-editing, Odd3-4E4 and Odd3-1C3
suggested retaining the allelic mutation in Odd3 cells. On the other hand, 4G5 cell line characterisation revealed
inheritance of in-frame deletions of 24 amino acids that do not cause loss of prohibition-2 function.
7. Aims and objectives
Prohibitin is identified and characterised as a receptor, and interacting protein mediated Dengue virus serotype-2
entry (Kuadkitkan et al., 2010). The study utilised insect cell line derived from Aedes mosquitoes. Using VOPBA
analysis, Prohibitin, conserved and expressed in the vast majority of eukaryotic cells, was identified when segregated
with susceptibility to infection. Co-immunoprecipitation demonstrated the interaction between Dengue virus and
Prohibitin. Moreover, the role of Prohibitin in insect cell entry was confirmed by small interfering RNA (siRNA), and
antibody mediated infection inhibition as well as colocalization of the virus and protein on the cell surface. The
characterisation of the interaction was only with dengue virus serotype-2. Thus, there is a possibility of interacting
with other dengue serotypes.
Therefore, we are aiming to identify and characterise prohibitin-2 as a receptor for the dengue virus in insect cell via
several stringent molecular and cellular techniques. Using CRISPR/Cas9, Dr Shiu-Wan has had knocked out the
prohibitin-2 gene to study the dengue virus-host interaction. Also, we are aiming to prove that the Prohibition-2
gene can be silenced using CRISPR/Cas9 genome manipulation tool which affects the functional role of Prohibition-2
gene. Prohibition-2 wild type must convert to bi-allelic mutation to achieve successful gene function silencing. A
successful Prohibition-2 gene silencing is critical in control the spreading and transmission of DENV by controlling the
vector, Aedes mosquitoes.
This project is a part of the main project started by Dr Shiu-Wan. An insect vector has been used to express a sgRNA
complementary to Prohibitin-2 gene of Aedes albopictus mosquito using CRISPR/Cas9 vector. Then the DNA plasmid
has been transfected into a C6/36 cell line. Therefore, C6/36 cells with a knockout in Prohibitin-2 is selected by
limited dilution, expanded, and Grown in cell culture to study the dengue virus-host interaction among single cells.
Hence, the objectives of this project are to create and maintain cell lines derived from C6/36 that previously
knocked out, and characterise these cells populations for genetic knockout of the putative dengue receptor,
prohibitin-2. After cell culture, DNA is extracted, amplified by PCR, and run on gel electrophoresis to identify INDELS
that will be confirmed by DNA sequencing.

8. STUDY DESIGN AND METHODOLOGY:
8.1. Study Design:
This project had been started by Dr Shiu-Wan Chan before we started, and we participated in the identification and
characterisation using cellular and molecular techniques. To provide an overview of project workflow (Figure 4), the
study design is described in three parts: the part done by DR Shiu-Wan Chan, that part done by Master students, and
future suggestions. The first part includes the following techniques and methods:
First, the cloning of sgRNA into plasmid vectors (E. coli). The vectors encode the Puromycin resistance gene (as a
selectable marker to indicate the success of a transfection), cas9. Secondly, transfection of the plasmid vector by
using a lipid. The cells continue to grow and passage maintaining selection pressure by keeping puromycin in the
growth medium (with and without puromycin). After 1-2 weeks, a large number of the cells were killed by the
puromycin, indicating that they did not take up or had lost the plasmid with the puromycin resistance gene. The cells
that remained growing in the puromycin-containing medium had retained the expression plasmid, which may have
stably integrated into the genome of the targeted cells.
The third stage is clonal selection: Select clonal populations of cells by transferring a well-isolated single clump of
cells (the clonal ancestor and cells derived from it) into a well in a 24 well plate; repeat to select 5-10 clonal
populations. Fourth, identify a single clone through limited dilution and expansion. Limited dilution has been used
with cells both with and without puromycin selection to isolate each cell that carries INDELS by placing them at very
low cell densities (<1 cell per well in 96 well plates), and expanding colonies from those single cells in separate wells
(24 wells then six wells plate).
Mono-allelic knockout cells have been created (2nd generation). A second CRISPR knockout has been performed on
these mono-allelic knockout cells to create bi-allelic knockout. This project is to screen the cloned cells, which are 3rd
generation cells, using cellular and molecular techniques, including cell culture, DNA lysate and extraction, PCR, and
gel electrophoresis as well as DNA sequencing for the bi-allelic knockout. The final part of the study depends on the
success of the second part, which uses techniques such as western blot and immunofluorescence assay to confirm
the gene silencing as well as to prove the hypothesis.

Materials and Methods
.1-Cell Culture
C6/36 is the parental cell line, which was derived from larvae of the Asian tiger mosquito, Aedes albopictus. The clones
4G5 and Odd3are derived from C6/36.These cells were isolated clonal cells in 96 wells, where we kept the cell expansion
and transferred the 70-90% confluent cells from a 96 well plate to 24 well plate then to 6 well plate.
Cells were kept under specific cell culture conditions at 28°C, 5% CO2. The cell line was maintained and grown in
Minimum Essential Medium Eagle (MEM) with Earle’s salts, 2 Mm L-glutamine, sodium bicarbonate (SIGMA); 10 %
Foetal Bovine Serum (FBS) (SIGMA-ALDRICH); MEM Non-Essential Amino Acids Solution (SIGMA-ALDRICH); 2 %
Penicillin-Streptomycin solution (SIGMA-ALDRICH).
8.2.2. Extraction of nucleic acids
Specimens were centrifuged for a minute to discard the supernatant, the growth medium. Then, the pallet was
washed with phosphate buffered saline (PBS). DNA was extracted from cultured cells with PureLink® Genomic DNA
Kits (Invitrogen) according to the manufacturer’s instructions; the cell was lysate using Proteinase K, RNase A, 96-
100% ethanol and PureLink® Genomic Lysis/Binding Buffer (Invitrogen) according to the manufacturer’s
specifications. DNA was washed with PureLink® Genomic Wash Buffers 1 and 2 by using PureLink® Spin Columns in
Collection Tubes according to the manufacturer’s specifications. DNA was eluted using sterile water.
8.2.3. DNA Quantitation
DNA Quantitation was carried out using a Thermo Scientific™ NanoDrop™, ND-1000 spectrophotometer instrument.
DNA absorbance was measured at 260 nm.
8.2.4. DNA amplification by Polymerase Chain Reaction (PCR)
PCR Mix was prepared to contain the following: 2 μl Taq buffer (1X Standard Taq buffer contains 10 mM Tris-HCl, 50
mM KCl, and 1.5 mM MgCl2, pH 8.3) , 0,4 μl of 10 mM deoxyribonucleoside triphosphate (dATP, dCTP, dGTP, dTTP),
0,4 μl of 10 μM IR (ccgctggaacttgattgggg), 0,4 μl of 10 μM IF (atattccggcgcggtgattg), 1 μg of DNA, and 0,1 μl of Taq
polymerase (New England Bio-Labs®) in a final reaction volume 20 μl of DNA. The cycle conditions for PCR were
94°C for 2 min, followed by 30 cycles of 94°C for 25 seconds, 54°C for 35 seconds, and 68°C for 1 minutes, and then
68°C for 7 minutes.
8.2.5. Detection of nucleic acids by Gel Electrophoresis
Nucleic acids were run on a 3 % agarose gel that was prepared with ethidium bromide and 1x Tris-acetate-EDTA
(TAE) buffer. Electrophoresis was performed with 100 volts for 1 hour and 45 minutes.
8.2.6. DNA SEQUENCING
PCR products were cleaned up using CleanSweep™ PCR Purification Kits by Invitrogen™ for sequencing. 6.4 μl DNA
was mixed with 2.6 μl clean-sweep (Invitrogen™). Then, it was incubated at 37°C for 15 and 80°C for 15 minutes

respectively. Next, 1 μl of 4 μM IF (atattccggcgcggtgattg) was added Sanger sequencing was done in the DNA
SEQUENCING facility at The University of Manchester, Stopford Building.
8.2.7. Data analysis
Chromas tool is used to view the sequences in chromatogram form. Tracking of Indels by DEcomposition (TIDE) is
web tool used to assess CRISPR-Cas9 genome editing (https://tide-calculator.nki.nl/); quantified the efficacy of
editing, and identified of Indels. CRISPR-ID is an application used to identify CRISPR indels in Sanger sequence
(http://crispid.gbiomed.kuleuven.be/). Clustal Omega is a tool used to generate multiple sequence alignments
(http://www.ebi.ac.uk/Tools/msa/clustalo/). ExPASy is translation tools used to translate nucleotides
(http://web.expasy.org/translate/).
10. Discussion
In this study, we have characterised cell population of two distinct cell lines, Odd3 and 4G5 cell lines, derived from
parent C6/36 cell for knockout of the putative dengue virus receptor, prohibition-2. Highlighting what Kuadkitkan et
al. (2010) have done which they identified Prohibitin as a receptor for dengue virus type-2 in insect cell line. Unlike
their study, we knocked out Prohibitin-2 using CRISPR/Cas9 while they knocked out Prohibitin using siRNA that have
less consistent knockdown and less gene inhibition when compared to CRISPR/Cas9 (Boettcher and McManus,
2015). The characterisation concluded achieving mono-allelic knockout in Odd3 cell line. Thus, Odd3 is re-edited
using CRISPR/Cas9 to achieve mutation on the other allele. The characterisation of cells derived from Odd3 cell line
after re-edition, Odd3-4E4 and Odd3-1C3 suggested retaining Odd3 allelic mutation. On the other hand, 4G5 cell line
characterisation revealed inheritance of in-frame deletions of 24 amino acids that do not cause loss of prohibition-2
expression. Likewise, CRISPR tool has been used by Marceau et al., (2016) to identified multi-protein complexes
associated with Endoplasmic-reticulum and involved in Dengue virus replication. Hence, we suggest the possibility of
achieving successful biallelic knockout in further editing.
Introduction of Cas9 and sgRNA induced a range of insertions and/or deletions (indels). Small indels produced by
cleavages are too small to detect easily using agarose gel (Zhang and Reed 2017). Thus, Sequencing of PCR products
of Odd3-4E4 showed mono-allelic mutation with insertions of 5 nucleotides, retaining the Odd3 mono-allelic
mutations. In contrast, Odd3-1C3 Showed deletion of 4 bp. On the contrary, 4G5 cell line that derived from C6/36
cells were sequenced which revealed two independent deletions, a removal of 22 and 24 bp. The 22 bp deletions
showed frameshift mutation, while 24 bp deletions showed in-frame deletions. The 24 bp deletions cause deleted of
8 codons keeping the reading frame in the same sequence, which does not cause loss of prohibition-2 expression
and losing of the function depends on whether the eight amino acids are necessary for function. Also, there is a
possibility to knock out gene function by introducing large deletions by further CRISPR editing, for example, Zhang et
al. (2015) were able to use CRISPR/Cas9 to generate large deletion and down-regulated Hox genes in insect cells.
This project is a part of a major project aimed to identified and characterised of a putative dengue virus receptor,
Prohibition-2, in insect cells. As a part of this project, we have described the knocked out-cells by Dr Shiu-Wan. The
characterisation detected the presence of mono-allelic knockout. These results are promising and indicate the

possibility of achieving successful bi-allelic knockout when re-editing cells again. As a result of the limited time of
this project, few cells were characterized. Also, the diploid cells need knockout of each haploid to achieve a bi-allelic
knockout. And this requires more time to perform. Thus, we suggested doing re-editing to cells that achieved a
monoallelic knockout and characterise the total population that might have the biallelic mutation.
In case of obtaining of a successful bi-allelic knockout, several techniques are used to confirm the prohibitin-2
protein as a putative receptor involved in Dengue virus entry of the insect cell. The techniques may include Western
blotting, virus overlay protein binding assay, immunofluorescence, or Antibody mediated infection inhibition assay
(Hai et al., 2014; Kuadkitkan et al., 2010; Salas-Benito and Del Angel, 1997). Prohibitin-2 is ubiquitous and conserved
protein with various roles and functions, but the entire function is still only partially understood (Mishra et al.,
2006). Prohibitin is the first identified and characterised receptor expressed in insect cell (Kuadkitkan et al., 2010).
Also, study above described the interaction with only dengue virus serotype-2. Thus, there is a possibility of
interacting with other dengue serotypes. Moreover, Prohibitin knew as conserved and ubiquitous protein (Mishra,
Murphy and Murphy, 2006). Hence, it also potentially interacts with dengue virus in mammalian cells. Thus, we also
suggest identifying Prohibitin as a putative receptor in mammalian cells.
The identification of Prohibition-2 as a receptor for dengue receptor will help to interfere the virus life cycle. Also, a
successful Prohibition-2 knockout is critical in control the spreading and transmission of dengue virus by vector
population suppression. Genetic approaches for controlling dengue vectors have aimed either to reduce wild-type
populations or to replace wild-type populations with mosquitoes that cannot transmit dengue virus (Robert et al.,
2013). We also can create transgenic mosquitoes carrying antipathogen effector genes targeting entry of dengue
virus to cells which this gene confers resistance to the transmission of the dengue (Gantz et al., 2015). In addition,
Gene drives using CRISPR/Cas9 reveal a mechanism for the formation of resistant allele and efficiency of gene drives.
For instance, a functioning gene drive could be rapidly distributed among an entire population to control
mosquitoes-borne diseases such as malaria (Champer et al., 2017). Once we identified Prohibitin-2 as DENV receptor
in mosquitoes, we can target the dengue vector mosquitoes via a CRISPR/Cas9 gene drive system. The development
of gene drives will suppress Aedes mosquito populations to a level which do not support dengue transmission. A
similar concept is achieved by Hammond et al. (2016) in malaria mosquito vector Anopheles gambiae suggesting the
success of gene driving technology.