Forensic Science and Criminal Justice: DNA Profiling Analysis
VerifiedAdded on  2020/10/22
|8
|2365
|428
Essay
AI Summary
This essay provides an overview of DNA profiling within the field of forensic science and its application in criminal justice. It begins by defining forensic science and its techniques, focusing on DNA evidence and its scientific basis, particularly DNA profiling. The essay delves into the strengths of DNA profiling, such as its role in paternity testing and identifying suspects. It also addresses the limitations, including potential technological errors, statistical probabilities, and the possibility of planted evidence, which can lead to miscarriages of justice. The essay recommends the use of advanced technologies and a broader consideration of evidence beyond DNA profiling to improve the reliability and accuracy of criminal justice proceedings. The conclusion summarizes the key points, emphasizing the benefits and limitations of DNA profiling, and advocating for a balanced approach to evidence in criminal cases.

Forensic Science and
Criminal Justice
Criminal Justice
Paraphrase This Document
Need a fresh take? Get an instant paraphrase of this document with our AI Paraphraser

Table of Contents
INTRODUCTION...........................................................................................................................1
MAIN BODY...................................................................................................................................1
Forensic science technique and its scientific basis.....................................................................1
Strengths and limitations of forensic science technique.............................................................3
Recommendations.......................................................................................................................5
CONCLUSION................................................................................................................................5
REFERENCES................................................................................................................................6
INTRODUCTION...........................................................................................................................1
MAIN BODY...................................................................................................................................1
Forensic science technique and its scientific basis.....................................................................1
Strengths and limitations of forensic science technique.............................................................3
Recommendations.......................................................................................................................5
CONCLUSION................................................................................................................................5
REFERENCES................................................................................................................................6

INTRODUCTION
Forensic science is a concept of applying scientific methods and processes to solving
crimes. This study is used to uncover mysteries, solve crimes and convict suspects of crimes. In
this essay, an understanding about DNA evidence is developed in order to determine strengths
and limitations of the forensic science technique. The main aim of this essay is to ascertain how
the concept of forensic technique is used as a evidence in court. In this essay, several
recommendations are also provided for the improvement of forensic science technique to prevent
future issues of justice which are often referred as miscarriages of justice.
MAIN BODY
Forensic science technique and its scientific basis
Forensic science is a field of study which helps in applying the techniques and methods
of science to solve criminal and civil laws. Investigation using this study requires governance of
legal standards in order to acquire admissible evidence and criminal procedure.
Deoxyribonucleic acid which is often referred as DNA is a double helix, which is used as a
evidence in lawful proceedings (DNA evidence, 2018). This evidence is not considered as a
physical evidence as it is not always visible from naked eyes due to which this evidence is
considered as biological evidence. These evidences are gathered from crime scenes such as,
vomit and may more and then investigated in forensic labs by professionals (Buckleton, Bright
and Taylor, 2016).
Forensic science techniques are the methods which includes a wide range of subjects and
experts. Objective of these techniques is to determine the cause of death, solve crimes, find
missing persons and recover lost or stolen data. In order to pursue, criminal justice there are
various forensic techniques such as physical, psychological, biological and digital techniques.
The specific forensic science technique which is used to gather DNA evidence is DNA profiling.
DNA profiling is a process of ascertaining an individuals DNA characteristics. This
process is a technique of scientific forensic. In order ascertain characteristics of a DNA it is
important to determine pattern of DNA which has a unique identical feature. Considering every
aspect of DNA of a human body, it has been observed that typically DNA is actually identical to
other people's DNA but there are some specific regions which highly vary from each other. This
region or variable is referred as polymorphisms. Every human or other creatures has a unique set
1
Forensic science is a concept of applying scientific methods and processes to solving
crimes. This study is used to uncover mysteries, solve crimes and convict suspects of crimes. In
this essay, an understanding about DNA evidence is developed in order to determine strengths
and limitations of the forensic science technique. The main aim of this essay is to ascertain how
the concept of forensic technique is used as a evidence in court. In this essay, several
recommendations are also provided for the improvement of forensic science technique to prevent
future issues of justice which are often referred as miscarriages of justice.
MAIN BODY
Forensic science technique and its scientific basis
Forensic science is a field of study which helps in applying the techniques and methods
of science to solve criminal and civil laws. Investigation using this study requires governance of
legal standards in order to acquire admissible evidence and criminal procedure.
Deoxyribonucleic acid which is often referred as DNA is a double helix, which is used as a
evidence in lawful proceedings (DNA evidence, 2018). This evidence is not considered as a
physical evidence as it is not always visible from naked eyes due to which this evidence is
considered as biological evidence. These evidences are gathered from crime scenes such as,
vomit and may more and then investigated in forensic labs by professionals (Buckleton, Bright
and Taylor, 2016).
Forensic science techniques are the methods which includes a wide range of subjects and
experts. Objective of these techniques is to determine the cause of death, solve crimes, find
missing persons and recover lost or stolen data. In order to pursue, criminal justice there are
various forensic techniques such as physical, psychological, biological and digital techniques.
The specific forensic science technique which is used to gather DNA evidence is DNA profiling.
DNA profiling is a process of ascertaining an individuals DNA characteristics. This
process is a technique of scientific forensic. In order ascertain characteristics of a DNA it is
important to determine pattern of DNA which has a unique identical feature. Considering every
aspect of DNA of a human body, it has been observed that typically DNA is actually identical to
other people's DNA but there are some specific regions which highly vary from each other. This
region or variable is referred as polymorphisms. Every human or other creatures has a unique set
1
⊘ This is a preview!⊘
Do you want full access?
Subscribe today to unlock all pages.

Trusted by 1+ million students worldwide

of polymorphisms which is gained from biological parents. DNA or polymorphisms is not only
present in humans but it also present in every living creature including plants and animals. This
variable of polymorphisms are investigated by technicians or criminalists. DNA profile is
document which includes patterns of DNA which are gathered from evidences found at crime
scene or location. For example, In a case of murder mystery a dead body is found at crime scene
and some evidences of blood. In order to solve this mystery, crime scene investigators or
criminalists examines polymorphisms of present in the DNA which is found in blood. By
investigating blood collected by investigator it can be ascertained whether the whole blood is of
one single individual or not. In case where blood which is collected also has traces of any other
individual, directs to the vision where traces of blood are investigated in order to ascertain
murder suspects. DNA profiling is a process which is used for various purposes. Some of those
purposes are: identification of probable origin of body fluid sample associated with a crime
scene. This process also helps to identify family relationships as it is a fact that a creature
acquires their DNA from their biological parents. Another benefit of this process is that this
helps in identifying victims which are engaged in any disaster. In an crime case, where it is hard
to ascertain identity of the death body as face and other features are severely damaged, DNA
profiling comes to a rescue as it can determine identify from various evidences present in that
body (Casey, 2011).
The technique of DNA profiling includes short tandem repeats which is a pattern of DNA
present in living creatures. These regions are are coded in the pattern of nucleotide sequence. For
example, GATAGATAGATAGATAGATAGATA is a sequence which is repeated six times. In
order to conduct a DNA profiling process, it is important to follow certain steps. First of all,
investigator is said to get a sample of DNA and than extract the DNA from the gathered sample.
Next step requires criminalist to copy the DNA to slide where pattern is required to determined.
In the last stage of this process, investigator ascertains the size of STR and then identify any
matching sample of that pattern in order to solve the mystery.
Scientific base refers to the evidence which provides an understanding that why a
particular technique is important or is used. Scientific basis of DNA profiling includes unique
characteristic of polymorphisms. The process of profiling is used by forensic pathologists to
determine actual evidences which provide support to identify main culprit of a criminal case.
Scientific basis of this technique is the evidence which provides rational that why a particular
2
present in humans but it also present in every living creature including plants and animals. This
variable of polymorphisms are investigated by technicians or criminalists. DNA profile is
document which includes patterns of DNA which are gathered from evidences found at crime
scene or location. For example, In a case of murder mystery a dead body is found at crime scene
and some evidences of blood. In order to solve this mystery, crime scene investigators or
criminalists examines polymorphisms of present in the DNA which is found in blood. By
investigating blood collected by investigator it can be ascertained whether the whole blood is of
one single individual or not. In case where blood which is collected also has traces of any other
individual, directs to the vision where traces of blood are investigated in order to ascertain
murder suspects. DNA profiling is a process which is used for various purposes. Some of those
purposes are: identification of probable origin of body fluid sample associated with a crime
scene. This process also helps to identify family relationships as it is a fact that a creature
acquires their DNA from their biological parents. Another benefit of this process is that this
helps in identifying victims which are engaged in any disaster. In an crime case, where it is hard
to ascertain identity of the death body as face and other features are severely damaged, DNA
profiling comes to a rescue as it can determine identify from various evidences present in that
body (Casey, 2011).
The technique of DNA profiling includes short tandem repeats which is a pattern of DNA
present in living creatures. These regions are are coded in the pattern of nucleotide sequence. For
example, GATAGATAGATAGATAGATAGATA is a sequence which is repeated six times. In
order to conduct a DNA profiling process, it is important to follow certain steps. First of all,
investigator is said to get a sample of DNA and than extract the DNA from the gathered sample.
Next step requires criminalist to copy the DNA to slide where pattern is required to determined.
In the last stage of this process, investigator ascertains the size of STR and then identify any
matching sample of that pattern in order to solve the mystery.
Scientific base refers to the evidence which provides an understanding that why a
particular technique is important or is used. Scientific basis of DNA profiling includes unique
characteristic of polymorphisms. The process of profiling is used by forensic pathologists to
determine actual evidences which provide support to identify main culprit of a criminal case.
Scientific basis of this technique is the evidence which provides rational that why a particular
2
Paraphrase This Document
Need a fresh take? Get an instant paraphrase of this document with our AI Paraphraser

technique is useful in a particular case. Major base of this method is the feature of uniqueness
which is tested under biological evidences which are determined through conducting polymerase
chain reaction and evaluation of samples (Geberth, 2016).
Scientific base of this technique can also include flexibility of a evidence. DNA of a
human can be collected by sample of a small quantity of blood or any other tissue. Not only
quantity, but this test of profiling can also be done from poor quality of tissue available for the
test. The above statements is the evidence that why this technique is widely used by investigators
of crime scene. After analysing DNA profiling, a technique of scientific forensic science and its
scientific basis it can be said this technique is most efficient and should be used for criminal
justice by crime scene investigators.
Strengths and limitations of forensic science technique
DNA profiling is a legally acclaimed technique which can be used for criminal cases
proceedings. According to the English legal system and their statute such as Civil and Criminal
Act, all the evidences gathered from scientific forensic technique of DNA profiling are
considered as valuable and even in some cases whole judgement is based upon these evidences.
There are various strengths of DNA profiling and some of them are discussed as follows. The
primary and most important strength of this technique is paternity which is used to identify who
is the alleged parent and who is the biological parent of an individual. Besides identification of
paternal individuals, this technique also helps in determination of twins as identical twins has
same generic material. Another strength of this technique is that it assist in determining sibling
relation from which it can be identified either the siblings has any biological relation or not.
From the point of view of criminal proceedings, criminal investigators can ascertain identity of
immigrants which requires proof of relatedness (Johnson, 2012).
In the case of criminal justice there are various benefits of the scientific forensic
technique of DNA profiling. As this method helps to solve crimes by comparing the DNA
profiles of suspects to offender samples. This test needs sample that contains cells with nuclei
due to which it is easy to find. Samples which can be obtained of a human are saliva, semen,
urine, blood, nail and hair. These tests are extremely sensitive which provides strength by which
even smaller units of samples can also help in serological tests. The most consistent strength of
DNA profiling is that it resists degeneration even after contamination with chemicals or bacteria
(McCartney, 2013).
3
which is tested under biological evidences which are determined through conducting polymerase
chain reaction and evaluation of samples (Geberth, 2016).
Scientific base of this technique can also include flexibility of a evidence. DNA of a
human can be collected by sample of a small quantity of blood or any other tissue. Not only
quantity, but this test of profiling can also be done from poor quality of tissue available for the
test. The above statements is the evidence that why this technique is widely used by investigators
of crime scene. After analysing DNA profiling, a technique of scientific forensic science and its
scientific basis it can be said this technique is most efficient and should be used for criminal
justice by crime scene investigators.
Strengths and limitations of forensic science technique
DNA profiling is a legally acclaimed technique which can be used for criminal cases
proceedings. According to the English legal system and their statute such as Civil and Criminal
Act, all the evidences gathered from scientific forensic technique of DNA profiling are
considered as valuable and even in some cases whole judgement is based upon these evidences.
There are various strengths of DNA profiling and some of them are discussed as follows. The
primary and most important strength of this technique is paternity which is used to identify who
is the alleged parent and who is the biological parent of an individual. Besides identification of
paternal individuals, this technique also helps in determination of twins as identical twins has
same generic material. Another strength of this technique is that it assist in determining sibling
relation from which it can be identified either the siblings has any biological relation or not.
From the point of view of criminal proceedings, criminal investigators can ascertain identity of
immigrants which requires proof of relatedness (Johnson, 2012).
In the case of criminal justice there are various benefits of the scientific forensic
technique of DNA profiling. As this method helps to solve crimes by comparing the DNA
profiles of suspects to offender samples. This test needs sample that contains cells with nuclei
due to which it is easy to find. Samples which can be obtained of a human are saliva, semen,
urine, blood, nail and hair. These tests are extremely sensitive which provides strength by which
even smaller units of samples can also help in serological tests. The most consistent strength of
DNA profiling is that it resists degeneration even after contamination with chemicals or bacteria
(McCartney, 2013).
3

In order to understand the strengths of DNA profiling technique it is important to develop
an understanding about the material component which is present in DNA due to which it has
these above several advantages. Material which is present in the DNA is same in all humans but
there is some variables which has a feature of uniqueness. These variable is a small portion of
material which is different in all individuals. These variables contains two generic types which
are scientifically known as alleles that are inherited from parents. Criminal justice is a structure
where various methods and processes are used to give valuable judgements in order to protect
victims and punish criminals. In order to punish criminals, it is important that scientific method
are used. The reason behind usage of scientific methods is that these methods are accurate and
reliable and even has a proper justification and evidence against every articulated argument.
When it comes to DNA profiling, there are various reasons and evidences which acts a pillar
which proves that this method is accurate and reliable as the feature of unique identity. DNA
profiling acts a test of fingerprints. It is a universal fact, that every human has different finger
prints, using this benchmark the concept of DNA profiling was generated and has various
strengths mentioned above which is used for criminal justice (Peterson, 2013).
Every scientific method has strengths as well as few limitations. DNA profiling is a
forensic technique, which are has few limitations which are discussed as follows: DNA profiling
is process which is conducted using different technologies and as mentioned by few critiques it is
considered that few technologies are unable to give accurate results. Errors which occur due to
some technologies are cross contamination of samples (Robertson, 2012). Another limitation of
DNA profiling is that it only offers statistical probability rather than absolute certainty. This
profiling tests are stored on computers which can be hacked by hackers. Some of the
investigators are critics has also pointed out various violations which occur due to ownership. In
the case of crime justice, the technique of DNA pro filings has few major drawbacks. First is
sample of DNA can easily be planted at the crime scene in order to divert the direction of the
case. Another drawback of this technique is that the reports of DNA profiling can easily be
forged due to which judgements related to the criminal cases will be inaccurate. Limitation of
absolute certainty is the major drawback of this technique as in few cases there is a requirement
of absolute results (Siegel and Saukko, 2012).
4
an understanding about the material component which is present in DNA due to which it has
these above several advantages. Material which is present in the DNA is same in all humans but
there is some variables which has a feature of uniqueness. These variable is a small portion of
material which is different in all individuals. These variables contains two generic types which
are scientifically known as alleles that are inherited from parents. Criminal justice is a structure
where various methods and processes are used to give valuable judgements in order to protect
victims and punish criminals. In order to punish criminals, it is important that scientific method
are used. The reason behind usage of scientific methods is that these methods are accurate and
reliable and even has a proper justification and evidence against every articulated argument.
When it comes to DNA profiling, there are various reasons and evidences which acts a pillar
which proves that this method is accurate and reliable as the feature of unique identity. DNA
profiling acts a test of fingerprints. It is a universal fact, that every human has different finger
prints, using this benchmark the concept of DNA profiling was generated and has various
strengths mentioned above which is used for criminal justice (Peterson, 2013).
Every scientific method has strengths as well as few limitations. DNA profiling is a
forensic technique, which are has few limitations which are discussed as follows: DNA profiling
is process which is conducted using different technologies and as mentioned by few critiques it is
considered that few technologies are unable to give accurate results. Errors which occur due to
some technologies are cross contamination of samples (Robertson, 2012). Another limitation of
DNA profiling is that it only offers statistical probability rather than absolute certainty. This
profiling tests are stored on computers which can be hacked by hackers. Some of the
investigators are critics has also pointed out various violations which occur due to ownership. In
the case of crime justice, the technique of DNA pro filings has few major drawbacks. First is
sample of DNA can easily be planted at the crime scene in order to divert the direction of the
case. Another drawback of this technique is that the reports of DNA profiling can easily be
forged due to which judgements related to the criminal cases will be inaccurate. Limitation of
absolute certainty is the major drawback of this technique as in few cases there is a requirement
of absolute results (Siegel and Saukko, 2012).
4
⊘ This is a preview!⊘
Do you want full access?
Subscribe today to unlock all pages.

Trusted by 1+ million students worldwide

Recommendations
DNA profiling is the technique which used in this essay to build an understanding about
DNA evidence and forensic scientific techniques. This technique is worldwide to gather
evidence for criminal proceedings. There are various limitations in this method due to which
some of the cases has face miscarriages of justice. In order to prevent future miscarriages it is
important to use advanced technologies which are able to provide reliable results. Another
recommendation for prevention is that criminal justice should not be only rely on evidence
gathered from DNA profiling and other evidences should be collected are considered as this ten
prove of DNA is not that accurate. This technique is useful but due to various drawbacks, other
evidences are also be used in future criminal proceedings.
CONCLUSION
From the above essay, it can be concluded that forensic science is a process and method
which is used in criminal justice to support the evidences in criminal cases which is required.
Technique of DNA profiling is used in this report from which it has been concluded that this
technique has various benefits but due to some limitations, judgements of criminal cases should
also consider other valuable evidences. After analysing scientific basis of this technique, it is
found that this technique helps to gain benefit with its feature of unique identity.
5
DNA profiling is the technique which used in this essay to build an understanding about
DNA evidence and forensic scientific techniques. This technique is worldwide to gather
evidence for criminal proceedings. There are various limitations in this method due to which
some of the cases has face miscarriages of justice. In order to prevent future miscarriages it is
important to use advanced technologies which are able to provide reliable results. Another
recommendation for prevention is that criminal justice should not be only rely on evidence
gathered from DNA profiling and other evidences should be collected are considered as this ten
prove of DNA is not that accurate. This technique is useful but due to various drawbacks, other
evidences are also be used in future criminal proceedings.
CONCLUSION
From the above essay, it can be concluded that forensic science is a process and method
which is used in criminal justice to support the evidences in criminal cases which is required.
Technique of DNA profiling is used in this report from which it has been concluded that this
technique has various benefits but due to some limitations, judgements of criminal cases should
also consider other valuable evidences. After analysing scientific basis of this technique, it is
found that this technique helps to gain benefit with its feature of unique identity.
5
Paraphrase This Document
Need a fresh take? Get an instant paraphrase of this document with our AI Paraphraser

REFERENCES
Books and Journals:
Buckleton, J. S., Bright, J. A. and Taylor, D. eds., 2016. Forensic DNA evidence interpretation.
CRC press.
Casey, E., 2011. Digital evidence and computer crime: Forensic science, computers, and the
internet. Academic press.
Geberth, V. J., 2016. Practical homicide investigation: Tactics, procedures, and forensic
techniques. CRC Press.
Johnson, D., and et. al., 2012. Use of forensic science in investigating crimes of sexual violence:
Contrasting its theoretical potential with empirical realities. Violence Against Women.
18(2). pp.193-222.
McCartney, C., 2013. Forensic identification and criminal justice. Willan.
Peterson, J. L., and et. al., 2013. Effect of forensic evidence on criminal justice case processing.
Journal of forensic sciences. 58. pp.S78-S90.
Robertson, J., 2012. Forensic science, an enabler or dis-enabler for criminal investigation?.
Australian Journal of Forensic Sciences. 44(1). pp.83-91.
Siegel, J. A. and Saukko, P. J., 2012. Encyclopedia of forensic sciences. Academic Press.
Online
DNA evidence. 2018. [Online]. Available through: <https://criminal.findlaw.com/criminal-
procedure/what-is-dna-evidence.html>
6
Books and Journals:
Buckleton, J. S., Bright, J. A. and Taylor, D. eds., 2016. Forensic DNA evidence interpretation.
CRC press.
Casey, E., 2011. Digital evidence and computer crime: Forensic science, computers, and the
internet. Academic press.
Geberth, V. J., 2016. Practical homicide investigation: Tactics, procedures, and forensic
techniques. CRC Press.
Johnson, D., and et. al., 2012. Use of forensic science in investigating crimes of sexual violence:
Contrasting its theoretical potential with empirical realities. Violence Against Women.
18(2). pp.193-222.
McCartney, C., 2013. Forensic identification and criminal justice. Willan.
Peterson, J. L., and et. al., 2013. Effect of forensic evidence on criminal justice case processing.
Journal of forensic sciences. 58. pp.S78-S90.
Robertson, J., 2012. Forensic science, an enabler or dis-enabler for criminal investigation?.
Australian Journal of Forensic Sciences. 44(1). pp.83-91.
Siegel, J. A. and Saukko, P. J., 2012. Encyclopedia of forensic sciences. Academic Press.
Online
DNA evidence. 2018. [Online]. Available through: <https://criminal.findlaw.com/criminal-
procedure/what-is-dna-evidence.html>
6
1 out of 8
Related Documents

Your All-in-One AI-Powered Toolkit for Academic Success.
 +13062052269
info@desklib.com
Available 24*7 on WhatsApp / Email
Unlock your academic potential
Copyright © 2020–2025 A2Z Services. All Rights Reserved. Developed and managed by ZUCOL.