Forensic Science and Crime Scene Analysis: A Case Study Report

Verified

Added on  2020/10/23

|9
|2873
|279
Report
AI Summary
This report presents an analysis of forensic science techniques applied to a case study involving a family murder. It explores the use of DNA profiling, polygraph tests, and blood spatter analysis. The scenario involves the murder of a family, with two daughters as potential suspects. The investigation utilizes various forensic methods, including blood sample analysis, lie detector tests, and sexual assault examinations, to determine the sequence of events and identify the culprit. The report critically analyzes the scientific basis and limitations of each technique, highlighting how forensic experts used the available evidence, including blood drops and witness statements, to reconstruct the crime scene and establish the motive behind the murders. The analysis also includes a discussion of how the techniques could have been improved to strengthen the investigation and ensure accurate conclusions.
Document Page
Forensic Science in Popular
Culture
tabler-icon-diamond-filled.svg

Paraphrase This Document

Need a fresh take? Get an instant paraphrase of this document with our AI Paraphraser
Document Page
Table of Contents
INTRODUCTION ..........................................................................................................................1
MAIN BODY...................................................................................................................................1
Overview of the case scenario................................................................................................1
Forensic science technique is used.........................................................................................1
Synopsis of the plot................................................................................................................3
Scientific basis for the technique............................................................................................4
Critical analysis of the technique...........................................................................................5
Suggest how the techniques used on the show could have been performed better................5
CONCLUSION................................................................................................................................6
REFERENCES................................................................................................................................7
Document Page
INTRODUCTION
Forensic science refers to a branch of science to criminal and civil laws which provide
support at the time of investigation about criminals by following actual legal guidelines for
admissible evidence and criminal procedure. It includes various kinds of techniques and
procedures including several biological and chemical tests which are helpful to gain various
evidences (Steenberg, 2013). There are different types of techniques which are utilized by
forensic experts such as fingerprinting or dactyloscopy, ballistics, discriminating between bloods
(serology), trace evidence (hairs, etc), lie detecting test (polygraph) postmortems, poisons and
their detection along with a great modern breakthrough of DNA. Moreover, this is very
important support for crime investigation department to solve any case in proper way as it assist
in finding out the actual culprit of particular crime. This assignment will focus on analytical
forensic science techniques including polygraph utilized in specific situation to catch the main
culprit.
MAIN BODY
Overview of the case scenario
According to the given scenario, four people of the family get murdered including father
mother with two brothers. Two teenage girls ran out of the house at and midnight screaming for
help. It was founded by investigators that, there was blood drops which conveys about sequence
of murderers of these people and make doubt on elder daughter Tina. Blood sample was founded
nearby bodies of victims. Moreover, it is also analyzed that these four people get murdered in
their house one- by- one. As per case study, the father was lying in the corridor, mother was in
her bedroom and two brothers are in their rooms with blood (Holtorf, 2016). Moreover, the
investigation team collected sample of blood from crime scene from different places in the house
and analyze about patterns of blood drops along with keeping in mind about mystery of named
“Buffalo”.
Forensic science technique is used
In this case, it is analysed that knife attacks are used by main culprit on four victims to
kill and analyse blood drops pattern in whole crime scene. The blood was collected from stairs,
wall of room, bed of victim, corridor where the dead bodies were founded to determine about
actual facts to understand presence of individuals at time of crime at victim's house. The
1
Document Page
techniques used in this case was polygraph testing which provide support to know about
difference in what the Overton admits. Polygraph is a famous tool used under the forensic
department to detect if a person is lying. It is helpful to catch particular person who is been
provide false statements to investigators. The machine initially records the baseline of the vital
signs and then records the changes that take place while instigation. According to the test it was
found out that there is a difference between what he was saying and what actually the truth is.
This test was of great help as through this it was clear that he was the murderer. Still the reason
behind same remained a question for the investigators which further led suspect on Tina the
younger daughter (Weaver and et. al., 2012).
DNA Profiling – This can be described as method to differentiate different types of
blood patterns to understand that who were died at which place at time of misdeed when it was
happening. Another way in which this technique is helpful is that through this the biological
detection of parent can be done. in the given case Tina said that Brenda is her daughter and the
authenticity of this statement can be made through conducting this test. If what Tina said is true
than there are high chances that the cause behind the murder is what stated by confessed by her.
Additionally, the blood samples are taken from crime scene make clear that drops of blood lying
on the stairs, corridors, rooms are different which create confusion about teal motivate behind
murders. Thus, it only describes about sequences of murdered these four people and make sense
about overall situation at time crime. Sampling of DNA profiling are collected through
swabbing, tape-lifting, or direct excision and them make slides of different Blood samples to
observe then under microscope along with carrying out other procedures to know different facts.
The techniques or DNA profiling has limitation that it may point finger on genuine person and
can violate someone's privacy.
Lie detecting test – This can be described as polygraph testing which is supportive to
analyse that witness or other relevant individuals of case provide correct views or not. As per
given case, Tina previously convey that her family do not want to allow her to go with boy friend
and due to this she will attempt their murder with help of Jesse. Additionally, marks of scooter
signs to doubt on this opinion of Tina and investigators conduct a lie detecting test carefully
which results into right confession of Tina. This technique of polygraph has limitation that it
depends upon unreproducible human intuition, guesswork, and methods that cannot conform to
recognizable science to ensure about results that it is accurately correct.
2
tabler-icon-diamond-filled.svg

Paraphrase This Document

Need a fresh take? Get an instant paraphrase of this document with our AI Paraphraser
Document Page
Examine sexual assault – This refers to conduct several pathological tests in order to
determine about sex assault of victim through determining their genital tract (Russell, 2017). It
includes to evaluate pregnancy, Extra genital injury, genital injury and presence of sexually
transmitted diseases. However, it is helpful to collect several biological evidences including
semen, blood, vaginal secretions, saliva, vaginal epithelial cells According to given case, it is
founded by forensic pathologist that genital injury was there which ensures that Brenda was
raped and has maternal side inside her body. Moreover, it clears about actual circumstances and
motive of murders along with proved opinions of being Tina true. Sexually abuse tests are
conducted through rape kit which may get expired and provide inappropriate results. It has
several limitations such as absence of comparison groups, lack of pre-testing on measures of
knowledge and skills, inadequate follow-up periods which make inaccurate outcomes.
Synopsis of the plot
In the given case study four family members were killed and two daughters some home
managed to escape and saved themselves. At first attempt of investigation, they skip taking blood
samples from stairs, corridors and corner of the wall which proved about circumstances of
murder of these four people of a family (Julian and et. al., 2011). Investigators considers that all
of these people get murdered by a person same on scooter on basis of marks of tyres but Tina,
give a different opinions. She said that she want to stay with her boy friend but her family will
not let her go with him so that he killed them all. After few days, the case get recheck including
several evidences, a forensic expert was thoroughly examine the crime place and then doubt in
views of Tina. Thus, they decide to conduct lie detecting test which facilitates to clear everything
including real motive of murders.
Apart from all this, new forensic expert also collect blood samples and then thoroughly
analyse patterns of blood drops which provide help to know about actual sequence of murders in
the house among these fours individuals. There are only a mysterious name “ buffalo” , marks of
scooter and patterns of blood drops in different places nearby four dead bodies. Additionally,
mapping of crime scene was carried out again and then conduct a lie detecting test to ensure
about her views. At last, it is clear that, she will plan murder of his mother, father and two
brother because she got sexually abused by her father and he also prefer Brenda for same
offence. Moreover, her mother and brothers do not take any action while she was became
pregnant.
3
Document Page
Scientific basis for the technique
The DNA (deoxyribonucleic acid) profiling is usually preferred by forensic pathologists
to determine actual evidences which provide support to catch main culprit of specific case
(Newell and Okome, 2013). Major useful technique is DNA profiling in a selected case on behalf
of which actual culprit and presence of individuals can be determined. It include the basic criteria
for testing biological evidences which are determine through conducting polymerase chain
reaction (PCR) and analyse samples of limited quality as well as quantity. Moreover, an
advanced form of PCR testing is considered as short tandem repeats (STR) which creates a DNA
profile that can be matched from DNA founded at crime scene. Moreover, DNA profiling
include DNA typing, DNA profiling, genetic fingerprinting, genotyping or identity testing.
Meanwhile, all of these are considered into an important branch of science known as genetics in
which isolation and identifying base pairs of DNA.
Now, the short tandem repeats are regions of non- coding DNA which contains a specific
nucleotide sequence i.e., GATAGATAGATAGATAGATAGATA that is an STR where a
nucleotide pattern GATA is repeated for 6 times. However, STRs are founded at different
genetic loci in DNA of a person. It is also identified that most of DNA is identical to other
people but some of regions are higher variable which are called as polymorphic and differences
in theses variables are known as polymorphism (Sanjukta, Dipankar and Sudeshna, 2011). The
DNA profiling using STR can be created by first taking sample of DNA through body cells
including blood, semen, hair roots or any other body tissue. Secondly, extraction of DNA is done
as it is founded in nucleus of cell and isolate it from other cell components. Thirdly, STRs are at
genetic loci which should be copied many times through PCR to gain sufficient DNA for making
profile. Moreover, separates the copied DNA by gel electrophoresis to determine match found
between two samples.
The Lie Detecting Test is very popular in forensic science and widely utilised in cases to
solve them in an appropriate manner. It include polygraph which is used for a long term to
analyse about true or false statement of individuals through help of technology. Thus, several
overall physiological functions to ascertain truth and falsehood in response are recorded to know
about truthfulness of witnesses in crime cases.
4
Document Page
Critical analysis of the technique
The DNA profiling is helpful to identify probable body fluid sample relevant to with a
particular crime scene which is helpful to catch the main culprit. It is also provide support to
reveal family relationships and determine disaster victims. In given case, the technique used by
forensic experts is analyse patterns of blood drops to determine actual scene of crime.
Previously, investigators they have only opinion of Tina, mysterious name “Buffalo” and marks
of scooter tyres which create certain confusion. Meanwhile, the real collected data was not not
sufficient because they only have blood samples of four people dead with patterns of blood drops
which claims that murder was attempt in sequence i.e., mother, gather and then two sons (Broth,
Laurier and Mondada, 2014).
After few days, when this case will get a fresh turn while forensic experts himself visit
crime scene and decide to conduct a lie detector test of Tina to investigate her opinions. The
newly appointed forensic pathologist examine her views and founded that she was lying to
investigators and then strictly carried out further enquiry to her. Further more, she confess that
her father raped her as well as Brenda and in nobody will support her in case of getting pregnant
so that she planned to kill them all. Through conducting test of sexually examine,it is proved that
Tina and her sister get raped before killing as her genital tract has certain injuries which claims
about their sexual assault with her. Moreover, her father was came out from Brenda's room at
that night, as she get sexually abused by her father and it was proved by analysing that she has a
maternal side in body. Additionally, blood patterns are collected which proves that who get
killed when and at which place in the house. But this time, evidences are enough to convince a
jury to the required standard of proof.
Suggest how the techniques used on the show could have been performed better
This are only tell about DNA profiling which is helpful to determine about collected
evidence but did not show it clearly. Apart from this, any other tests are not properly described
but only show an image of DNA which is not sufficient for people to know that what is actually
DNA profiling. Moreover, details about sexually assault was not clear and how they determine
about the same. From above discussion, it has been suggested that DNA profiling should be
properly showed to audience so that it can be properly visible to them (Hutchins and Rowe,
2013). Apart from this, scene of forensic laboratory was repeated many timers whenever talking
about forensics in the episode which not more effective and lie detecting test should be clearly
5
tabler-icon-diamond-filled.svg

Paraphrase This Document

Need a fresh take? Get an instant paraphrase of this document with our AI Paraphraser
Document Page
showed to make audience understand the same. They are required to show that how forensic
experts works and then provide views about specific case. Moreover, several important facts
about injuries regarding sexually abused should be conveyed to people which make them easily
understand about whole story.
CONCLUSION
The above reports is conclude that forensic science is branch of science which deals with
several biological and chemical tests to support legal investigation of crime. As per opinion of
Tina, these two girls i.e., Tina & Brenda got raped by their father as their genital tract has certain
injuries and Brenda has maternal side in her tract. Final confessions of Tina claims about real
motive of murders. Meanwhile, when forensic pathologist investigate through carried lie
detecting test to ensure real motive of murder along with conducting medical check ups of two
girls which ensures that they got sexually assault by their father as Tina said. At last, main
motive of attempt to murder is to take revenge from whole family who does not support the girl
as she got raped by her father.
6
Document Page
REFERENCES
Books and journals
Steenberg, L., 2013. Forensic science in contemporary American popular culture: Gender,
crime, and science. Routledge.
Holtorf, C., 2016. Archaeology is a brand!: The meaning of archaeology in contemporary
popular culture. Routledge.
Weaver, R. and et. al., 2012. The CSI effect at university: forensic science students’ television
viewing and perceptions of ethical issues. Australian Journal of forensic sciences.
44(4). pp.381-391.
Russell, R. V., 2017. Pastimes: The context of contemporary leisure (No. Ed. 6). Sagamore
Publishing.
Julian, R. D. and et. al., 2011. What is the value of forensic science? An overview of the
effectiveness of forensic science in the Australian criminal justice system project.
Australian Journal of Forensic Sciences. 43(4). pp.217-229.
Newell, S. and Okome, O. eds., 2013. Popular culture in Africa: the episteme of the everyday.
Routledge.
Sanjukta, D., Dipankar, S. and Sudeshna, C., 2011. Media, gender, and popular culture in India:
tracking change and continuity. Sage Publications Ltd.
Broth, M., Laurier, E. and Mondada, L. eds., 2014. Studies of video practices: Video at work.
Routledge.
Hutchins, B. and Rowe, D. eds., 2013. Digital media sport: Technology, power and culture in the
network society. Routledge.
7
chevron_up_icon
1 out of 9
circle_padding
hide_on_mobile
zoom_out_icon
[object Object]