University Biology: Questions and Answers Assignment

This assignment provides answers to a series of short questions covering core concepts in molecular biology. The questions address topics such as the function of restriction enzymes and the products of their action, the essential features of yeast artificial chromosomes (YACs) and their construction, the principle of quantitative PCR (qPCR) and its applications, and a supplementary methodology for protein separation using 2D gel electrophoresis. The assignment also explores methods for detecting genetically modified organisms (GMOs) in food products, the critical considerations in primer design and optimization of annealing temperature for PCR assays, the nature and consequences of splice site mutations, the differences between forward and reverse genetic screening approaches, and the process of DNA replication. The answers provided demonstrate an understanding of the key concepts and techniques in the field of molecular biology.

Running head: QUESTIONS AND ANSWERS
Questions and answers
Name of the Student
Name of the University
Author Note

1QUESTIONS AND ANSWERS
SHORT ANSWERS:
Answer 1:
a) BamHI creates 5’ overhang after cleaving at these restriction sites after first G on the
sequence
5’ GGATCC 3’
3’ CCTAGG 5’
After cleavage it produces the following overhang sequence
5’ G 3’ 5’ GATCC 3’
3’ CCTAGG 5’ 3’ G 5’
b) BcII produces a 5’ overhang after cleaving at these restriction sites after first T on the
sequence
5’ TGATCA 3’
3’ ACTAGT 5’
After cleavge it produces the following overhang sequence
5’ T 3’ 5’ GATCA 3’
3’ ACTAG 5’ 3’ T 5’
c) i. If the sequence is cut by BamHI, it will produce two fragments
A- 5’GTTCAG 3’ B- 5’ GATCCGTAATTCCTGATTCACGCTCCA 3’
3’ CAAGTCCTAG 5’ 3’GCATTAAGGACTAGTGCGAGGT 5’
d) ii. If the sequence is cut by BcII, it will produce two fragments
C- 5’ GTTCAGGATCCGTAATTCCT 3’ D- 5’ GATCACGCTCCA 3’
3’ CAAGTCCTAGGCATTAAGGACTAC 5’ 3’TGCGAGGT 5’
e) If we join A + D, it will give the ligated sequence as

2QUESTIONS AND ANSWERS
5’GTTCAGGATCACGCTCCA 3’
3’ CAAGTCCTAGTGCGAGGT 5’
f) No, the ligated fragment can neither be cut with BamHI or BcII because the
recognition and cut site has been destroyed on the newly ligated sequence for both the
restriction enzymes. This is because the restriction enzymes cut at specific sites on the
DNA sequence by recognizing the sequence.
Answer 2:
YAC or yeast artificial chromosome is a modified or recombinant from of bacterial
plasmids with essential features of yeast chromosome making it capable of replicating within
the host that is yeast as well as Escherichia. coli. In order to replicate inside yeast the size of
the vector should be large that is around 1000 kb where the insert can be around 500 kb. The
features from yeast chromosomes for making a vector suitable as yeast artcificial
chromosome to replicate inside yeast-
 Linear DNA produced from circular plasmid of bacteria by breaking the circulization
with restriction enzymes.
 Centromere to ensure that chromosome is partitioned to two daughter cells as CEN
sequences
 Telomer regions at each end of the linear DNA to stabilize the chromosome ends as
TEL sequences
 Autonomously replicating sequence (ARS) for replication and preserving YAC inside
yeast cells. Therefore these act as origin of replication.
 Yeast marker genes such as URA3 and TRP1 for selection and screening of uracil and
tryptophan autotrophy respectively inside yeast
 SUP4 supressor gene for red or white colour selection after DNA insert.

3QUESTIONS AND ANSWERS
 HIS3 for histidine slection
The features of YACs are developed from yeast centromere shuttle-plasmids.
To replicate inside bacteria, the YAC contains features from bacterial plasmid-
 Beta-lactamase gene bla
 Bacterial pMB1 as bacterial origin of replication
 Multiple cloning site for restriction enzymes
 Bacterial slectable marker such as ampicillin resistant gene AmpR from pBR322
plasmid (Bajpai, 2014).
Fig 1: a) linear form of YAC and b) circular form of YAC (Image retrieved from Bajpai,
2014)
Answer 3
The principle of quantitative PCR is based on the measurement of amount of
amplification that is not possible with conventional PCR. This type of PCR does not require

4QUESTIONS AND ANSWERS
agarose gel electrophoresis to visualize the amplicon and its quantity because analysis of
melting curve will determine the amount. It uses flurescent dyes in the polymerase chaun
reaction to measure the amount of amplication by flashes of fluorescence. The PCR mixture
contains DNA molecules or target DNA, primers, DNA polymerase and buffer in
conventional PCR but in q-PCR, the addition of flurophor or a probe that will bind to the
target DNA during amplification inside the thermal cycler will measure the fluorescence of
the the fluorophor when it reaches an excited wavelength. This will allow the measurement of
one or more products of amplification at each PCR cycle and the data generated will be
calculated as relative gene expression of samples on a computer software. The process goes
as follows- denaturation at 95 °C, primer binding at 50-60 °C and elongation of
polymerization at 68-72 °C (Furda et al., 2014).
Answer 4:
Since the crude protein extract after resolving it with SDS-PAGE contained many
proteins of similar molecular weight therefore these molecules having similar mases should
be separated based on their electrical charge. The technique applied is 2-D gel electrophoresis
in which the purified proteins at first are separated on the basis of their electrical charge and
then separated on the basis of their molecular weight in SDS PAGE. This will allow speration
of similar molecular weight proteins because two unrelated proteins will always differ in their
net charges on the sequences. The process begins when the isoelctric focusing is used as the
first dimension followed by SDS-PAGE. The process followed-
 First the 8M urea is used to denature the cell extract and layered on a glass tube
containing ampholytes.
 Then electric field is passed through the ampholyte which seperates the solution based
on the net charge. The polyanionic ampholytes will remain at one end and polycaionic
at other end of the tube thereby establishing a pH gradient.

5QUESTIONS AND ANSWERS
 The proteins keep on migrating at each end till it reaches isoelectric pH thereby
resolving the protein by one uinit of charge.
 Then a second dimension is used where polyacrylamide gel is run under electric field
for resolving proteins by molecular weight and it makes use of SDS (Lodish et al.,
2000).
Figure 2: 2-D gel electrophoresis (Image retrieved from Lodish et al., 2000)
Answer 5:
Presence of gentically modified organisms can be detected in food vua various
amplication and sequencing methods. One common strategy to identify and quantify GMO is
by using qPCR. This type of detection technique is benficial for both processed and
unprocessed food because amplicons of size 100 are also amplified. Firstly the presence of
GMO in food is assessed using a screening method where the common transgenic elements
that are likely to be present in GMO are targeted and it includes p35S that is 35S promoter

6QUESTIONS AND ANSWERS
originated in cauliflower mosaic virus and tNOS that are terminators for nopaline syntghesis
in Agrobacaterium tumefacians. Other than this there are marlers distinct for the specific
GMO such as t35S PpCAMBIA and Cry3Bb can be used for detection. Primers are
developed specifc for the target sites such as the markers and it amplies the target sites which
are further detected as fluroesecence in qPCR. The second step is more specific detection via
targeting construct specific markers that is the markers present in the cassette of the
transgenic gene in the GMO or in the junction of plant genome and the transgenic cassette.
Finally the quantification of the detected transgene or its markers is performed from the
tested food or sample (Fraiture et al., 2015).
Answer 6:
a) Primer design for PCR is a critical area where specific features of the primers
determine the success rate of PCR reaction. The optimal length of the primers that
include both forward and reverse primers should be around 18-22 base pairs in length.
This is because the length is adequate for specific and easy primer binding to the
template during annealing process. Primers should have melting temperature (Tm)
between 52-58 o C. The GC content of the primer should be high that is around 40-
60% of the total primer bases. The last five bases at 3’ end should be either C or G
which will help specific and strong binding to the template.
b) Optimal primer annealing temperature is maintained to ensure stability between the
DNA-DNA hybrid. The annealing temperature should not be too high so that primers
are not sufficiently bound to the template and product yield is low. On the other hand
if the annealing temperature is too low it may lead to non-specific binding on the
template resulting in undesired products due to increased mismatches. The optimal
annealing temperature should be calculated based on the melting temperature of the
primer as well the product. The optimum annealing temperature should be between

7QUESTIONS AND ANSWERS
the range 50-60 °C depending on the composition of primer (Bustin & Huggett,
2017).
Answer 7:
Pre-mRNA formed after transcription undergoes splicing mechanism to form mRNA
trancripts required for proper translation of protein. Splicing depends on the recognition
of cis-sequences of exon-intron and regulatory regions. Any point mutation occurred in
these consensus sequences then it may cause improper splicing recognition of exon and
intron thereby forming aberrant transcripts from the muated genes. This type of mutation
is known as splice-site mutation. Mutation can occur in any region of the intron or the
exon causing disruption of the intronic or exonic splice sites or regulatory region splice
sites. This results in errorneous splicing process and undesired intron removal leading to
changed open reading frames (Anna & Monika, 2018).
Fig 3: splice site mutation: 1: shows that a point mutation is present in the junction of intron
and exon 2 which leads to improper recognition by the splicing mechanism and
misincorporation of intron in the altered mRNA whereas in 2, point mutation has is present in
exon 2 which does not allow the splicing enzymes to recognize exon 2 and thus the altered
2

8QUESTIONS AND ANSWERS
mRNA has excluded exon 2 during splicing (Image retrieved from National Cancer Institute,
2020).
Answer 8:
Genetic screnning is a process used for identifying the function of a gene and
understand gene interaction. Screening is mainly done by introducing mutation in genes and
assessing the desired phenotype in the affected organism. It can be classified as forward
genetic approach and reverse genetic approach. In forward genetic approach random
mutations are in the gene are screened to understand which genes are responsisble for a
particular phenotype. On the other hand reverse genetics is applied where specific genes are
targeted for mutation to find out the phenotype produced. Forward genetic approach is also
known as “pehenotype to gene” approach whereas reverse genetic approach is also known as
“gene to phenotype”. These approaches are applied in animal model experiment where
diseases are identified by experimenting in animal models such as mouse. Forward genetics is
useful is finding out the causes of many human diseases and its characteristics. Gene
targeting or knockout in mouse is an example of reverse genetic approach to find out the
function of the gene. Disruption of a gene will associate with the disease responsible for its
absence (Gondo et al., 2017).
Answer 9:
Replication is the first process of central dogma where the double stranded DNA
(dsDNA) is copied into new set of double stranded DNA before it is divided into the daughter
cells making two pairs of DNA strands from one of paternal DNA strand. The process begins
with recognition of the ori region by an enzyme known as DNA A, which opens the duplex at
the ori site. The ori site is rich in A-T base pairs. This facilitates the binding of another
enzyme called helicase that that unwinds the dsDNA forming two single strands. The structre
formed is known as replication fork. To stabilise these single strands, single stranded binding

9QUESTIONS AND ANSWERS
proteins (SSBs) binds to the strands and removes any tortional strain and renaturation of
DNA. Another enzyme known as topoisomerase II or DNA gyrase that requires ATP to
introduce negative supercoiling by cleaving both strands, passing a segment through the
break to the other site and then seals the cut. In the presence of gyrase and SSBs, primase
comes into action that adds primer (a short stretch of RNA nucleotides) to the
complementary regions of the single strands. This is the initiation phase of replication. Primer
addition will be followed by addition of complementary nucelotides to the single strands right
after the primer. There two strands of DNA known as lagging and leading starnd based on the
direction of nucleotide addition. Addition of nucleotides to the leading strand occurs from 5’
to 3’ in a continuous process and requires only one primer but the synthesis of lagging strand
is a discontinuous process away form the replication fork requiring many primers bound to its
complementary strand. Finally the elongation process ceases and the primers are removed by
DNA polymerase I. DNA pol I also fills in the gap of primer site and does proof reading of
the correct incorporation of nucleotides. The enzyme ligase joins the phosphodiester bonds
between the nucleotides and seals any gap. The replication process is terminated when the
replication fork reaches Ter sites or termination sites (Duderstadt et al., 2014).
Fig 4: replication process (Image retrieved from A Level Biology, 2020)
Answer 10:
Sanger sequencing is a first generation sequencing which is absed on chain
termination by incorporation of dideoxynucleotides to find out an unknown sequence. The

10QUESTIONS AND ANSWERS
reaction mixture requires single stranded DNA template, specific primer sets, enzyme that is
DNA poylmerization for addition of nucelotides, four types of dNTPs or deoxynucleotides
and ddNTPs or dideoxynucleotides that terminates the chain elongation due to the absence of
hydroxyl group at the 3’ of the ribose thereby not forming phosphodiester bond with the
incoming dNTP. The unknown DNA sequence samples are separated equally into four tubes,
where each of the test tubes contain all components of the reaction reaction but each test tube
differs in the content of ddNTPs. Every test tube will contain only type of dNTP. The
reaction follows the PCR amplification where the final product is visualized under gel
electrophoresis that reveals the sequence by indication of the positions of four lanes relative
to each test tube reaction. The sequence is read form the lower band to the top. On the other
hand pyrosequencing which is a second generation sequencing where the nucleotide sequence
of the DNA are determined by release of pyrophosphate molecules. It follows similar reaction
components such as sanger sequencing that include DNA template, dDNTPS, DNA
polymerase and primers but additional compnents are required to detect the release of light
based on chain reaction. The additional components are ATP sulfurylase, luciferase and
apyrase. The reaction begins as addition of dDNTP next to the primer by DNA polymerase
where apyrase removes any dNTP not incorporated or mismatched. Sequential addition of a
nucleotide bases A, T, G and C releases PPi for every correct base pairing. This
pyrophosphate (PPi) is converted to ATP by ATP sulfurylase, further ATP acts as a substrate
for luciferase mediated reaction where luciferin is converted to oxyluciferin and light is
generated for each nucleotide addition (Ihle et al., 2014).
Answer 11:
Allele dropout is the loss of one allele during amplification in polymerase chain
reaction of DNA. The reason for allele dropout is the failure of amplification of one allele. It
is difficult to recognize the mistake in the PCR reaction because PCR reaction is successful

11QUESTIONS AND ANSWERS
but the gentic information is not available. Allele dropout is the reason for causing
homozygosous or heterozygosous mutations.
To determine the mechanism of allele dropout, a study was conducted for genotyping
of a human gene that is MEST. PCR analysis of the short region in the promoter sequence of
MEST revealed that led to the genotype patterns of non-mendelian type with regard to three
single nucleotide polymorphisms or SNPs. This problem could not be resolved by primer
redesign or standard optimization of PCR. It was established that presence of methylation on
cytosine and certain DNA structures such as G-quadruplexes in the promoter region was
responsible for allele dropout leading to misinterpreted genotyping. These guanine bases
forms a connection between each other through hoogsteen bonds. G4 structures comprise of
four guanine nucelotides that stack upon one another and this structure formation is
facilitated by the cations present in the buffer. These structures inhibit the Taq polymerase
activity and the affect is intensified when these G4 regions are methylated (Stevens et al.,
2017).
LONG ANSWERS:
Answer 1:
a) Gene expression profiling of carcinogen X should be performed with the help of RT
PCR or reverse transcriptase PCR which will quantify the gene expression or amount
of transcript from the gene expression of X.
b) The procedure to be followed for RT PCR of carcinogen X is as follows
 Purification of whole genome from the cells through cell disruption
 Separation of total cellular RNA for conversion into cDNA

12QUESTIONS AND ANSWERS
 cDNA conversion requires specific enzye known as reverse transcriptase
enzyme along with dNTPs, buffer, and primer specific for poly A tail of
transcript.
 This is the reaction for cDNA synthesis. The above mentioned mixture in the
reaction is heated for few minutes at 65 C.
 Then RNase inhibitor is added and heated at 70 C for inactivation of the
enzyme reverse transcriptase.
 The cDNA is converted from single stranded RNA. The sequence of cDNA
contains only exons that are expressed.
 The amplification of cDNA by running PCR is the second process which
requires same components of reaction mixture as the conventional PCR.
However the primer set should be preformed and complementary to the
specific regions of carcinogen X in cDNA. The reaction mixture also requires
flurophor or probes to detect the amount of flurescence upon binding to the
cDNA molecules.
 The PCR reaction mixture is run and final prodict is detected as fluorescence
signals.
 The PCR products can be visualised by PAGE and
 Therefore RT PCR can detect the gene expression of a particular gene such as
the carcinogen X by quantifying its amount of expression in the form of
transcripts inside cells.
c) To find out the patterns of expression in genes that are repressed or induced by the
presence of a carcinogen X can be determined using DNA microarray. DNA
microarray is used to identify expression of a large number of genes at once. The
technique uses hybridization method of binding probes to specific regions of the

13QUESTIONS AND ANSWERS
genes. The probes are designed as such that it contains short fragment of gene
complementary to the DNA element of the gene whose expression is to be analysed.
The DNA to be attached to the probes are first converted to cDNA so that their
amount of expression inside the cells can be determined. The probe is labelled with a
flurophor or any chemiluminescence target which will quantify the amount and
presence of the target gene attached to the probe. The probes of various
complementary sequences are attached on a solid surface either polysterene bead or
glass beads. Different probes can have different coloured flurorescent labels attached
to identify the quantified DNA and comapare it with control DNA expression
(Lisowska et al.,2014)..
In the experiment, the carcinogen X is known to induce 2 genes and repress 3
genes, however the exact sequence is unkown or the exact genes are not known.
Therefore to conduct the microarray process, the probes should contain
complementary sequences for genes expressed in the human liver cells and different
fluorescent labels. The total RNA or transcript should be extracted and purified from
human hepatocytes after it has been treated with carcinogen X and this will be
referred as treated sample. Another sample containing total transcript from liver cells
that are not treated by carcinogen X will be referred as control for comparison of
expression with the treated sample. Both the samples will undergo cDNA conversion.
These cDNA samples will be used for hybridization with the probes attached with
fluorescent labels. The treated and the control samples will be flushed onto separate
microarray plate containing probes. As soon as the probes hybridizes to its
complementary cDNA sequences, the labelled fluorophor emits fluorescence light
specific to the probe. The amount of fluorescence is detected and image of different
coloured spots are analysed. The spots are compared with the control sample spots

14QUESTIONS AND ANSWERS
and the amount of expression is determined by quantifying the fluorescence emitted in
each of the treated and control sample. The genes which are induced or supressed are
also identified by analyisng the complementary probe sequence. The genes induced
by carcinogen will show more expression and genes repressed will show less
expression in terms of fluorescence in treated samples when compared to the same
genes in the control sample.
Answer 2:
a) Gene therapy is a technique of using genes to treat a disease by either replacing a
mutated gene with a healthy gene, or inactivating a mutated gene or introducing a new
gene for fighting against a disease.
Gene therapy has several therapeutic benefits for curing genetic disorders. Gene
therapy can be of two types- invivo and ex-vivo gene therapy. Hematopeotic stem
cells can be targeted for gene therapy because it can correct conditions at the
beginning and since stem cells have self-renewal property, it will ensure that the
modfifications done in the gene will be passed onto the progeny and is stably inserted
into the chromatin either mediated by viral vector or in-situ. Diseases such as beta-
thalassemia, x-linked severe combined immunodeficiency, Wiskott–Aldrich
syndrome (WAS) along with some neurodegenerative disorders are cured by using
stem cell gene therapy. However it has some limitations for using viral vectors that
inserts genes near oncogenes can cause leukemia in patients. In-vivo gene therapy of
liver cells can be directed for treating haemophilia B and other metabolic diseases
using human parvo-virus as vectors and is administered intravenously. However some
hurdles are faced that include acute inflammatory response that causes toxicity
towards the bolus administration of these vectors in the bloodstream because the
viruses are inactivated by previously present antibodies that clear off the vectors from

15QUESTIONS AND ANSWERS
the body (Naldini, 2015). Cancer can also be treated by ex-vivo gene therapy because
it boosts up the immune response in case of various cancers and HIV. In this case
transduction occurs by using lentiviral vectors that expresses a transgene containing
antigen associated with cancer such as T-cell antigen receptor. This type of gene
therapy is used as immunotherapy and is beneficial for patients with T-cell or B-cell
malignancies (Schumacher & Schreiber, 2015).
b)Antisense therapy is the use of antisense RNA to treat genetic diseases. When the
genetic sequence of a specific gene causing a disease is known, it is possible to
synthesize an antisense strand with the help of mRNA encoded by that gene. This anti-
sense mRNA will bind to its sense strand and inactivate it. There are several mechanisms
of antisense therapy for treating various diseases. in treating cancer, antisense therapy can
be used for inhibiting gene expression that will decrease the progression of tumor.
Premature transcription inhibition can be done by degrading the target mRNA and correct
abnormal cell growth in tumor. However there is limitation in delivering the antisense
oligo at the site of tumor due to lack of proper delivery system. Another way of reducing
cardiovascular disease is by using antisense RNA against apolipoprotein B mRNA. This
antisense RNA decreases the expression of apolipoprotein thus lowering the risk of
cardiovascular disease. Drugs such as volanesorsen is being investigated for use in
reducing apo CIII mRNA levels. However this drug can cause side effects such as renal
disease in patients with hemodialysis. Another antisense drug that is mongersen taken
orally reduces the mRNA levels of SMAD7 associated with inflammatory bowel disease
and ulcerative colitis. Antisense therapy has also been used in treating neurological
disorders when it is directly injected into the cerebrospinal fluid to treat brain and spinal
cord disorders.the antisense RNA binds to the specific regions of introns or exons that
degrades the mRNA before splicing occurs (Sharad, 2019).

16QUESTIONS AND ANSWERS
Answer 3
a) Quantitative real-time PCR can determine gene duplications or deletions.
Furthermore, melting curve analysis immediately after PCR can identify small
mutations, down to single base changes. These techniques are becoming easier and
faster and can be multiplexed. Real-time PCR methods are considered a constructive
option for the analysis of markers in cancer. Real-time PCR has specific features for
use in the clinical laboratory in performing tumor profiling (Rifai et al., 2018).
b) RNA sequencing (RNA-Seq) is a method that utilizes high-throughput sequencing
trechnique to provide information on the complete transcriptome including coding as
well as non-coding RNA sequences. It is useful indetermining a large number of
mRNA markers that differentiate between cancer subtypes comparing with healthy
controls. It also determines novel genes and different splicing products after
alternative splicing of pre-mRNA. Most cancers shows exon skipping and retention of
introns during splicing events. Disease specific transcriptome and unknown
transcripts related to the disease can be prompted (Zhang et al., 2017).
c) Some molecular targets for colon and breast cancer are carcinoembryonic antigen and
epidermal growth factor receptor respectively that are detected in the circulating
cancer cells in cancer patients with the help of RT PCR (Guo et al., 2015). Prostate
specific antigen and antigen on its membrane are non-specific to malignancy of
prostate. Prtostate cancer cells can be detected in the circulatory blood with the help
of RT PCR because they ahave high specificity for prostate epithelia (Stone &
Crawford, 2015).
d) Melting curve analysis is used to assess the dissociation of double stranded DNA
under high temperature. Upon increasing the temperature the double stranded DNA
starts separating into sibgle strands leading to increase in the intensity of absorbance

17QUESTIONS AND ANSWERS
which is also known as hyperchromicity. The energy needed for introducing break in
the double stranded DNA is based on its GC pair length and content along with their
complementary. The dissociation can be measured by using a fluorophor that
intercalates between DNA bases. Measuring the dissociaition will indicate the
reduction in the fluorescence. Melting curve shows peaks of various sizes and from
the peaks, different amplicons of PCR will be interpreted.
Applications- it can be used to detect single nucleotide polymorphisms (SNP) and the
homozygosity or heterozygosity of the mutated allele by determining the patterns of
dissociation. SNP is associated with many gentic diseases hence melting curve
analysis will detect the presence of SNP and disease associated with it (Matsuda,
2017).
Answer 4:
a) In the experiment, gene expression study cannot be by cDNA microarray because this
technique cannot be used for analysing only two genes. DNA microarray is carried
out for multiple gene expressions at a single time. Microarray is useful for gobal
expression profiling and the genes analysed are not affected by preselction of genes.
Microarray plates contain several probes having sequences specific to several genes
or transcripts therefore not useful in performing gene expression analysis of only two
genes.
b) Two methods that can be used in the experiment are quantitative PCR and northern
blot. qPCR is carried out by the following protocol-
 RNA of two gene samples are extracted and purified.
 cDNA synthesis for conversion of the RNA to cDNA by reverse transcriptase
 cDNA is the template for PCR cycle.

18QUESTIONS AND ANSWERS
 PCR reaction mixture contains template, primer specific for the cDNA
regions, buffer, RNase inhibitor and polymerase enzyme. A fluorescent label
is attached along with primers
 The PCR reaction begins with appropriate temperature set up for denaturation,
annealing and extension.
 At each PCR cycle, a graph with peak will determine the quantification of
amplicon by emission of fluorescence.
Protocol for Northern blot-
 RNA extraction
 Gel electrophoresis to separate RNA by sizes
 Transfer the RNA to nylon or nitrocellulose membrane (blotting)
 Addition of labelled probes specific to the RNA sequence of interest and its
attachment
 Washing off the unattached probes from the membrane
 Visualization of probe hybridized with RNA under x-ray film
 Fluorescence will determine the expression of specific genes
c) cDNA microarrays are used under circumstances of analysing expression of several
genes at a time. When one will compare the expression of one treated gene with a
normal gene, this method is appropriate. Cancer cells have specific gene expression
which normally differ from normal cells. The expression of certain genes can be
analysed to understand whether those genes are overexpressed or silenced in cancer
cells. Gene expression of similar genes in different organism can also be analysed to
understand the presence of polymorphism in their genes. cDNA microarrays are
useful in diagnosing genetic origin of diseases (D’Angelo et al., 2014).

19QUESTIONS AND ANSWERS
Answer 5:
To create a vaccine for chicken flu virus, genes encoding for the flu virus protein
coats such as H1 and HA genes will be used as antigens for elcitating immunity against the
flu virus. The virus and its genome sequence is known. Therefore the gene responsible for
causing the flu symptoms will be extracted and cloned in a cloning plasmid and delivered to
the host by directly injecting it to the muscle of the host. The muscle take up the protein
encoded by the antigen and elicitates both humoral and cell-mediated response (Lee et al.,
2018).
To deliver the vaccine a suitable vector will be bacterial plasmid. Plasmid contains
tragene that can encode various proteins in the form of antigens to increase the eficiiency of
the vaccine The plasmid should contain viral gene promoter, multiple cloning site for
insertion of target gene by restriction enzyme and bacterial origin of replication, antibiotic
resistance gene and a poly-adenylation site for termination (Gómez & Oñate, 2018).
Answer 6
a) Chain-termination sequencing, popularly known as Sanger sequencing can be
described as a DNA sequencing technique is based on the technique where chain-
terminating dideoxynucleotides are incorporated at the end of the chain via the use of
DNA polymerase during the process of DNA replication in-vitro. This method was
invented by Fredrick Sanger, and even though it has currently been replaced by more
developed methods such as Next Generation DNA sequences, it still remains in use
for small-scale projects and laboratories. In this process, the modified ddNTP that are
incorporated lacks 3’-OH group that terminates chain elongation. The fluorescent tag
in different nucleotides helps to determine the sequence.
The sequence-by-synthesis method is another DNA sequencing method which
is much more advanced. This method utilizes four fluorescent-labelled nucleotides

20QUESTIONS AND ANSWERS
which enables the accurate sequencing of the huge number of nucleotides in the
sample. In the course of each sequencing cycle, a single-labelled DNTP is
incorporated on the DNA chain, thus giving accurate sequence of the template
strand (Sikkema‐Raddatz et al., 2013).
b) The major difference between two processes is that Sanger sequence was slow, and
time consuming. On the other hand, the sequence-by-synthesis approach as utilized by
Illumina is faster and more accurate. Sanger sequencing is a low throughput method,
while Illumina is high throughput.
Answer 7
a) X-linked recessive disorder is a condition that is inherited due to X-linked recessive
inheritance. In this mode of condition, a mutation is present in a gene on the X-
chromosome. The resulting phenotype is always expressed in the males due to the
presence of a single X chromosome. In females, the phenotype is only expressed
when they are homozygous in nature, as in both the X chromosomes contain the same
mutation. Even though the phenotype is not expressed in the heterozygous females,
they may act as a carrier of the disorder. Examples of well-known X-linked recessive
disorders include Haemophilia, red-green colour-blindness and Duchenne muscular
dystrophy.
In haemophilia A, a mutation in the Factor VIII gene causes a deficiency of
Factor VIII in the individual. It is a blood-clotting protein, deficiency of which causes
the inability of blood to clot on a cut or wound. This was thought to be common in the
descendants of Queen Victoria which was later found to be Haemophilia B (Gholami
et al., 2018).

21QUESTIONS AND ANSWERS
a) When genetic disease has been diagnosed in a patient, several steps can be taken to
help the individual as well as their family. In a genetic condition, the treatment or
management plans are based on the symptoms and the factors of the disease. For
example, the genetic defect related to heart defect, a surgery may be able to correct it.
For sickle cell anaemia, it may be corrected with a bone marrow transplant. Apart
from that, some therapy sessions may be required to help the family and the patient to
cope with it. Some families may feel troubled by the fact that a closed one has a
underlying condition. So, family therapy may be a helpful option.
Answer 8:
a) Homologous models- the symptoms, causes and alternatives of treatments is identical
for both animals and humans having the same disease.
Isomorphic model- only symptoms and treatments are same for both animals and
human. The diseases have different etiology in humans and animals
Predictive model- this shows analogous symptoms and causes to human disease.
However treatment characteristics exhibited is same (McGonigle & Ruggeri, 2014).
b) Cell lineage is the developmental background of a differentiated cell that is tracked
back to find out the origin of cell. C.elegans have invariable lineages between the
organism whereas vertebrate have variable cel lineage patterns. The cell lineage is
dependent on finding the ancestral history of an organism by cell division and
development with time and it starts with the originator cell and finishes at matured
cell and not further division occurs. Characterization of cell lineage can be done
without genetic analysis by visualizing phenotypic characteristics of organisms.
Organisms having similar physiologic characteristics and tracing their ancestors by
looking at the phylogenetic tree of animals. The charcteristics include physical

22QUESTIONS AND ANSWERS
appearances, metabolism differences and various pther functions (Papaioannou,
2016).
c) Gene expression is an important factor in determining whether an overexpression or
low expression levels will lead to a disease. Here impaired differentiation of cell
functions will lead to diseases that are organ specific and show chronic symptoms
such as Alzheimer’s disease and other such chronic disease. Chronic diseases often
causes morbidity due to alteration in the function of organs that are differentiated
from a cell lineage. Therefore analysing the expression level of specific genes will
relate to the alteration in the function of the organ or tissue in animals. Expression of
specific gene markers relate to its cell lineage (Ju et al., 2013).
Answer 9:
a) Transcription begins at the promoter site of the dsDNA where the binding of the RNA
polymerase at specific site takes place. RNA polymerase identifies the a sequence that
is 25-35 bp upstream of the transcription start site which consist of consensus
sequence TATA or the TATA box. Binding at TATA box assures that transcription
begins from the correct nucleotide. Some control region are located proximal to te
promoter region and some are distant known as enhancers. These regions the control
the level of expression by either activating or silencing the expression. Proximal
control regions also known as CCAAT box functions as a cis-acting sequence
enriched with GC base pairs.
b) Intron-exon junction is the site of conjuction between one intron or non-coding
sequence and one exon or coding sequence. These sites are important recognition sites
for the spliceosome compex in the splicing process. Splicing pattern of the pre-mRNA
can be established by the organisation of intron nd exon. These allow the splicing

23QUESTIONS AND ANSWERS
factors to recognize the ends of exon, keep them together by splicing out the
intergenic regions.
c) Cap site is found in the 5’ end of the processed mRNA after post-transcriptional
modification. The 5’ cap consists of 7-methyl guanosine and is modified from a
molecule of guanosine triphosphate. The function of the cap is to protect mRNA from
degradation, translocation of mRNA from the nucleus to the cytoplasm and
recognition of the ribosome for translation.
d) The tail at the 3’ end consists of polymers of adenine residues. It is added to the
mRNA as soon as the elongation step of transcription is competed. This structure
gives stability to mRNA and serve as a recognition site for attachment of translational
factors during initiation of translation. An enzyme called poly-A poulymerase adds a
sequence consisting of 200 adenine residues to the end of 3’ just after the cleavage of
pre-mRNA fhas occurred (Alberts, 2017).

24QUESTIONS AND ANSWERS
Fig 6: Regulation of transcription (created by author)
Answer 10:
a)
PARAMETERS 2D GEL
ELECTROPHORESIS
REVERSED-PHASE LIQUID
CHROMATOGRAPHY

25QUESTIONS AND ANSWERS
PRINCIPLE To separate any complex mixture
of proteins based on isoelectric
focussing and the relative
molecular weight of the proteins
(NCBI, 2020).
To separate molecules such as
proteins and peptides on the
basis of hydrophobicity
(Amersham Biosciences, 2020).
PROCEDURE At first, the cell extract is
denatured using urea followed by
passing of electric field through
the ampholyte thus, separating
the solution based on the net
charge. Then, polyacrylamide gel
is run under electric field to
resolve the protein as per the
molecular weight.
The protein mixture to be
separated is applied on the
sorbent in presence of buffers.
Then the solutes are eluted by
pouring organic solvent on it.
Elution can be done by keeping
the organic solvent concentration
constant or by increasing the
amount of organic solvent.
Proteins eluted in the increasing
order of hydrophobicity.
ADVANTAGE It resolves larger protein
molecules and stains the protein
for easy quantification.
It is used for separating polar as
well as non-polar molecules with
molecular weight below 2000
Daltons.
DISADVANTAG
E
Disadvantages include limited
reproducibility, huge quantity of
sample handling and small
dynamic range.
This procedure induces protein
denaturation, which is a
disadvantage.

26QUESTIONS AND ANSWERS
b) i. The advantages of mass spectrometry include the molecular weights can be detected
even from a very little sample. It also does not involve any absorption or emission of
light. It also exhibits the ability for measuring isotopic ratios (Marshall & Verdun,
2016).
ii. The experimental plan is as follows (Chemguide, 2020).
Inlet=
Sample Introduction
Source
Analyzer
Ion Detector
Data System
Data Output
Gas Phase Ions
Ion Detection
Ion Sorting
The signals are recorded and
the results are shown in the
computer

27QUESTIONS AND ANSWERS
Answer 11:
Epigenetics can be defined as the subject for studying the heritable changes in the expression
of gene, which does not involve any changes in the DNA sequence. It can be also explained
as the change in phenotype without any significant changes in the genotype. It occurs
naturally and are generally influenced by various factors, which include age, disease and way
of living. The epigenetic changes can be triggered by the modification of the histone, DNA
methylation and non-coding RNA associated gene silencing (Kim & Costello, 2017).
One such disease that occurs due to genetic and epigenetic changes is Fragile X
Syndrome. It is a genetic disorder, which occurs due to a mutation in the fragile X mental
retardation (FMR1) gene present on the X chromosome. The mutation causes an increase of
the CGG repeats present on the 5’ untranslated region of FMR1 gene. The epigenetic changes
of the disease is the heavy methylation of the CGG trinucleotide repeats (Hagerman et al.,
2017).

28QUESTIONS AND ANSWERS
References:
A Level Biology, 2020. Introduction To DNA Replication | A-Level Biology Revision Notes.
[online] A Level Biology. Available at:
<https://alevelbiology.co.uk/notes/introduction-to-dna-replication/> [Accessed 5 April
2020].
Alberts, B. (2017). Molecular biology of the cell (6th ed.). Garland science.
Amersham Biosciences. (2020). Reversed Phase Chromatography. Retrieved 6 April 2020,
from
http://wolfson.huji.ac.il/purification/PDF/ReversePhase/AmershamRPCManual.pdf
Anna, A., & Monika, G. (2018). Splicing mutations in human genetic disorders: examples,
detection, and confirmation. Journal of applied genetics, 59(3), 253–268.
https://doi.org/10.1007/s13353-018-0444-7
Bajpai, B. (2014). High Capacity Vectors. In Advances in Biotechnology (pp. 1-10). Springer,
New Delhi.
Bustin, S., & Huggett, J. (2017). qPCR primer design revisited. Biomolecular detection and
quantification, 14, 19–28. https://doi.org/10.1016/j.bdq.2017.11.001
D’Angelo, G., Di Rienzo, T., & Ojetti, V. (2014). Microarray analysis in gastric cancer: a
review. World journal of gastroenterology: WJG, 20(34), 11972.
Duderstadt, K. E., Reyes-Lamothe, R., van Oijen, A. M., & Sherratt, D. J. (2014).
Replication-fork dynamics. Cold Spring Harbor perspectives in biology, 6(1),
a010157.

29QUESTIONS AND ANSWERS
Fraiture, M. A., Herman, P., Taverniers, I., De Loose, M., Deforce, D., & Roosens, N. H.
(2015). Current and new approaches in GMO detection: challenges and
solutions. BioMed research international, 2015.
Furda, A., Santos, J. H., Meyer, J. N., & Van Houten, B. (2014). Quantitative PCR-based
measurement of nuclear and mitochondrial DNA damage and repair in mammalian
cells. In Molecular Toxicology Protocols (pp. 419-437). Humana Press, Totowa, NJ.
Gholami, M. S., Valikhani, M., Dorgalaleh, A., Mousavi, S. H., & Pezeshkpoor, B. (2018).
Hemophilia A. In Congenital Bleeding Disorders (pp. 103-137). Springer, Cham.
Gómez, L. A., & Oñate, A. A. (2018). Plasmid-Based DNA Vaccines. In Plasmid.
IntechOpen.
Gondo, Y., Makino, S., & Fukumura, R. (2017). Forward and Reverse Genetics to Model
Human Diseases in the Mouse. In Animal Models for the Study of Human
Disease (pp. 727-752). Academic Press.
Guo, M., Li, X., Zhang, S., Song, H., Zhang, W., Shang, X., ... & Hao, H. (2015). Real-time
quantitative RT-PCR detection of circulating tumor cells from breast cancer
patients. International journal of oncology, 46(1), 281-289.
Hagerman, R. J., Berry-Kravis, E., Hazlett, H. C., Bailey, D. B., Moine, H., Kooy, R. F., ... &
Hagerman, P. J. (2017). Fragile X syndrome. Nature reviews Disease primers, 3(1),
1-19.
Ihle, M. A., Fassunke, J., König, K., Grünewald, I., Schlaak, M., Kreuzberg, N., ... &
Merkelbach-Bruse, S. (2014). Comparison of high resolution melting analysis,
pyrosequencing, next generation sequencing and immunohistochemistry to

30QUESTIONS AND ANSWERS
conventional Sanger sequencing for the detection of p. V600E and non-p. V600E
BRAF mutations. BMC cancer, 14(1), 13.
Ju, W., Greene, C. S., Eichinger, F., Nair, V., Hodgin, J. B., Bitzer, M., Lee, Y. S., Zhu, Q.,
Kehata, M., Li, M., Jiang, S., Rastaldi, M. P., Cohen, C. D., Troyanskaya, O. G., &
Kretzler, M. (2013). Defining cell-type specificity at the transcriptional level in
human disease. Genome research, 23(11), 1862–1873.
https://doi.org/10.1101/gr.155697.113
Kim, M., & Costello, J. (2017). DNA methylation: an epigenetic mark of cellular
memory. Experimental & molecular medicine, 49(4), e322-e322.
Lee, L., Izzard, L., & Hurt, A. C. (2018). A Review of DNA Vaccines Against
Influenza. Frontiers in immunology, 9, 1568.
https://doi.org/10.3389/fimmu.2018.01568
Lisowska, K. M., OIbryt, M., Dudaladava, V., Pamuła-Piłat, J., Kujawa, K., Grzybowska,
E., ... & Kupryjańczyk, J. (2014). Gene expression analysis in ovarian cancer–faults
and hints from DNA microarray study. Frontiers in oncology, 4, 6.
Lodish H, Berk A, Zipursky SL, et al. Molecular Cell Biology. 4th edition. New York: W. H.
Freeman; 2000. Section 3.5, Purifying, Detecting, and Characterizing
Proteins. Available from: https://www.ncbi.nlm.nih.gov/books/NBK21589/
Loenen, W. A., Dryden, D. T., Raleigh, E. A., Wilson, G. G., & Murray, N. E. (2014).
Highlights of the DNA cutters: a short history of the restriction enzymes. Nucleic
acids research, 42(1), 3-19.
Marshall, A. G., & Verdun, F. R. (2016). Fourier transforms in NMR, optical, and mass
spectrometry: a user's handbook. Elsevier.

31QUESTIONS AND ANSWERS
Matsuda, K. (2017). PCR-based detection methods for single-nucleotide polymorphism or
mutation: real-time PCR and its substantial contribution toward technological
refinement. In Advances in clinical chemistry (Vol. 80, pp. 45-72). Elsevier.
McGonigle, P., & Ruggeri, B. (2014). Animal models of human disease: challenges in
enabling translation. Biochemical pharmacology, 87(1), 162-171.
Naldini, L. (2015). Gene therapy returns to centre stage. Nature, 526(7573), 351-360.
National Cancer Institute, 2020. Understanding Cancer. [online] National Cancer Institute.
Available at: <https://www.cancer.gov/about-cancer/understanding> [Accessed 5
April 2020].
NCBI. (2020). Two-dimensional PolyAcrylamide Gel Electrophoresis. Retrieved 6 April
2020, from
https://www.ncbi.nlm.nih.gov/Class/NAWBIS/Modules/Protein/protein18.html
Papaioannou, V. E. (2016). Concepts of cell lineage in mammalian embryos. In Current
topics in developmental biology (Vol. 117, pp. 185-197). Academic Press.
Rifai, N., Horvath, A. R., Wittwer, C. T., & Park, J. (Eds.). (2018). Principles and
Applications of Molecular Diagnostics. Elsevier.
Schumacher, T. N., & Schreiber, R. D. (2015). Neoantigens in cancer
immunotherapy. Science, 348(6230), 69-74.
Sharad, S. (2019). Antisense Therapy: An Overview. In Antisense Therapy. IntechOpen.
Sikkema‐Raddatz, B., Johansson, L. F., de Boer, E. N., Almomani, R., Boven, L. G., van den
Berg, M. P., ... & Sinke, R. J. (2013). Targeted next‐generation sequencing can
replace Sanger sequencing in clinical diagnostics. Human mutation, 34(7), 1035-
1042.

32QUESTIONS AND ANSWERS
Stevens, A. J., Taylor, M. G., Pearce, F. G., & Kennedy, M. A. (2017). Allelic Dropout
During Polymerase Chain Reaction due to G-Quadruplex Structures and DNA
Methylation Is Widespread at Imprinted Human Loci. G3 (Bethesda, Md.), 7(3),
1019–1025. https://doi.org/10.1534/g3.116.038687
Stone, N. N., & Crawford, E. D. (Eds.). (2015). The Prostate Cancer Dilemma: Selecting
Patients for Active Surveillance, Focal Ablation and Definitive Therapy. Springer.
Zhang, Y. H., Huang, T., Chen, L., Xu, Y., Hu, Y., Hu, L. D., Cai, Y., & Kong, X. (2017).
Identifying and analyzing different cancer subtypes using RNA-seq data of blood
platelets. Oncotarget, 8(50), 87494–87511. https://doi.org/10.18632/oncotarget.20903