Molecular Biology Lab Report: Gene Cloning and Expression

This molecular biology lab report details an experiment focused on inserting a gene (either rfp or amilCP) into a plasmid vector (pTTQ18) and verifying its expression. The experiment involved restriction digests of the vector and gene, followed by agarose gel electrophoresis to separate the fragments. A ligation reaction was then performed to insert the gene into the vector, and Sanger sequencing was used to confirm successful insertion and the gene sequence. The results, including gel electrophoresis images, red/white screening results, and Sanger sequencing chromatograms, demonstrated the successful cloning and expression of the gene of interest. Analysis of the chromatogram revealed the gene sequence matching the amilCP gene, confirming the experiment's success. The discussion compares the findings with existing literature and concludes the experiment successfully achieved its aim.

Running head: BIOLOGY
MOLECULAR BIOLOGY
Name of the Student
Name of the University
Author Note

1BIOLOGY
Table of Contents
Introduction................................................................................................................................2
Aim.........................................................................................................................................2
Objectives...............................................................................................................................3
Method.......................................................................................................................................3
Results........................................................................................................................................4
Discussion..................................................................................................................................7
References..................................................................................................................................9

2BIOLOGY
Introduction
Plasmid vectors have been used for a very long time after their discovery in the field
of molecular biology. These vectors have been found to be used mainly for carrying selected
gene sequences from one host to another. For example, the insulin gene has been
incorporated in numerous plasmid vectors and has been found to be expressed in E. coli,
naming the process as artificial insulin synthesis (Jang and Ahn 2019). The general
procedures involve cutting the vector and the gene fragment with the same restriction
enzymes to induce proper ligation between the vector and the sequence. Restriction enzymes
play a major role in these reactions between the vector and the sequence because the ligation
fails to occur if proper restriction enzymes are not used in the experiment. PCR is an
important process of these types of experiments because it is used to separate the vector and
digest on the gel post to which they will be ligated after being separated from the gel. Sangers
sequencing is a traditional sequencing method which has been used to confirm the genome
sequence which has been ligated in the vector molecule (Hebert et al. 2018). Sequencing
confirms whether the target gene has actually been inserted into the vector or not. Various
laboratory experiments aiming to achieve the same goal of restriction digest and vector digest
ligation uses the method of sangers sequencing to confirm the fact that the vector has the
gene of interested ligated inside it (Mardis 2017). The next section will discuss the aim and
objectives of this experiment. After the same, this laboratory report will state the method used
to perform the experiment followed by the generation of the results and finally ending the
paper with a brief discussion of the results based on the data obtained from secondary
research sources.
The aim of this experiment is to incorporate a gene (rfp or amilCP) inside the plasmid
vector (pTTQ18). The secondary aim of this experiment is to check whether these two genes

3BIOLOGY
are properly inserted and expressed in vitro or not. The confirmatory test will be done with
the help of Sanger’s sequencing to check whether the gene of interest has actually inserted
into the vector or not.
The objectives of this experiment are as follows:
To perform restriction digests of both the vector and gene of interest.
To perform agarose gel electrophoresis to separate the fragments.
To perform ligation reaction for the insertion of the gene into the vector
To perform Sanger’s sequencing to check whether the gene has actually entered the vector or
not.
Method
The normal laboratory protocol has been used for this experiment. This method was
properly followed in order to avoid any types of problems with the results. A similar
procedure has already been used by many research studies for expressing a specific gene of
interest inside a vector after amplifying the same by PCR.
The procedure of this experiment will follow the protocols used in a previous research
article based on the same aim (Khan et al. 2017). The restriction digest was set up for each of
the reported gene PCR product and pTTQ18. The master mix of the reaction consisted of 10
microliter DNA, 6 microliter sterile distilled water, 2 microliter 10x SmaI+ KpnI buffer, 1
microliter KpnI and 1 microliter SmaI. The microfuge racks were kept on the front bench and
incubated for 1 hour at 37 degree centigrade. The samples were loaded and run on an agarose
gel which had 4 microliter loading buffer and 20 microliters of samples. This procedure has
been followed according to a research paper which also aimed at restriction digestion agarose
gel electrophoresis (Bertero, Brown and Vallier 2017). The marker DNA was properly loaded

4BIOLOGY
in order to separate their bands properly to compare the size of the sample bands after the
electrophoresis is over. The gel was run for 30 minutes at 100 V. After the run was complete,
the digested DNA was purified from the agarose gel and the ligation reaction was set up
using vector: DNA ratio of 3:1. The samples were incubated according to the general
laboratory protocol used for this experiment. A higher number of vectors were given to
ensure that the product ligates with the vector.
The red white screening process of transformation with E.coli cells was performed in
this experiment. This step has been done according to the standard protocol for red white
screening as done in a research study (Lai et al. 2018). All the transformants were isolated
and were finally exposed to Sanger’s sequencing. The cells were heat shocked fat 42 degree
centigrade for 1 minute and 950 microliter of broth was added to it. This was properly mixed
and incubated at 37 degree centigrade for 30 minutes. 50 microliter of the sample was plated
onto Nutrient agar ampicillin plates. Both the red and white colonies were counted and DNA
was extracted for Sanger sequencing. This test has been found to be required to test the
efficiency of ligation between the chosen vector and the DNA.

5BIOLOGY
Results
Fig 1: Gel electrophoresis results of the vector and gene restriction digests
Source: UV trans-illuminator
10000
5000
700
200 bp
10000
5000
700
200 bp

6BIOLOGY
Fig 2: Red white screening plate for recombinant (vector + gene) identification
Source: Petri plate direct observation
Red
colony
White
colony

7BIOLOGY
Fig 3: Chromatogram obtained for the gene sequence inserted into the vector (Sanger
sequencing)
Source: Blue chromatogram
Figure 5: BLAST results of the insert
Source: BLASTn
Discussion
Figure 1 shows the agarose gel electrophoresis results obtained in the form of bands
of gene and vector. White coloured bands are visible on a black background of the gel under
a UV transilluminator.

8BIOLOGY
Figure 2 shows the results of red white screening obtained from plating the E. coli
population containing the restriction digest ligation products (vector+gene).
Figure 3 shows the Sanger sequencing results obtained from a blue chromatogram
which shows the gene sequences of rfp which is inserted into the vector.
All the well components in the gel electrophoresis have shown clear amplification
which can be observed to be around 500 bp length for the selected gene product known as the
coral protein. For the cloning vector, the size was around 4000 bp. These results also matched
with a similar restriction digest performed with the same cloning vector in another
experiment (Mardalisa, Suhandono and Ramdhani 2020). In the results for the red white
screening, it has been identified that few of the colonies showed transformation and
recombination. After isolating the colonies, their genomes were sequenced to locate the
sequence of the inserted gene.
Considering the chromatogram, it can be stated that background noise was very less
and thus the result was clear. From the chromatogram, it can be observed that at the
beginning of the sequencing process the peaks were not proper due to the existence of
background noise. However, sharp peaks have been found in the chromatogram staring from
T-33. The sequence obtained from the chromatogram is 5’-
TTGGCGCATATTTATTGTTTTCGAG………CC-3’. This sequence has been found to
match the genomic sequence of amilCP gene (Zhou et al. 2017). In other words, it can be
stated that the gene sequence has successfully inserted itself inside the cloning vector chosen
for the experiment. Also, in this chromatogram, there was no misspeaks which was evident
from the fact that there was no N in the list of nucleotides shown by the chromatogram.
However, irregular spacing can be observed between the G-81 and A-82. Thus it can be
stated that there was a dinucleotide in the original genome sequence. Although there were no

9BIOLOGY
miss calls in the middle region of the sequence and the end, there was still a large number of
miss calls from 10 to 30 base pair of the genome sequence. Double or heterozygous peaks
were also observed at the beginning of the sequence before the 10th base pair. This condition
is visible due to the existence of single nucleotide polymorphism at the region of the
sequence. After running a blast with the sequence, it was found that maximum homology was
associated with Acropora millepora chromoprotein mRNA. Thus, it was again concluded that
the genome sequence has been completely inserted into the vector, otherwise, this sequence
could not have been found to be homologous with amilCP. This was the overall discussion of
the experiment which states that the experiment was successful and the digest has
successfully been ligated with the chosen cloning vector.
References
Aubry, C., Pernodet, J.L. and Lautru, S., 2019. Modular and Integrative Vectors for Synthetic
Biology Applications in Streptomyces spp. Applied and environmental microbiology, 85(16),
pp.e00485-19.
Bertero, A., Brown, S. and Vallier, L., 2017. Methods of Cloning. In Basic Science Methods
for Clinical Researchers(pp. 19-39). Academic Press.
Hebert, P.D., Braukmann, T.W., Prosser, S.W., Ratnasingham, S., DeWaard, J.R., Ivanova,
N.V., Janzen, D.H., Hallwachs, W., Naik, S., Sones, J.E. and Zakharov, E.V., 2018. A Sequel
to Sanger: amplicon sequencing that scales. BMC genomics, 19(1), p.219.
Jang, B. and Ahn, Y.J., 2019. Enhanced recombinant insulin production in transgenic
Escherichia coli that heterologously expresses carrot heat shock protein 70. Biocatalysis and
Agricultural Biotechnology, 20, p.101180.

10BIOLOGY
Khan, A.A., El-Sayed, A., Akbar, A., Mangravita-Novo, A., Bibi, S., Afzal, Z., Norman, D.J.
and Ali, G.S., 2017. A highly efficient ligation-independent cloning system for CRISPR/Cas9
based genome editing in plants. Plant methods, 13(1), p.86.
Lai, H.E., Moore, S., Polizzi, K. and Freemont, P., 2018. EcoFlex: A multifunctional moclo
kit for E. coli synthetic biology. In Synthetic Biology (pp. 429-444). Humana Press, New
York, NY.
Mardalisa, M., Suhandono, S. and Ramdhani, M., 2020, January. Isolation and
Characterization of str Promoter from Bacteria Escherichia coli DH5α using Reporter Gene
AmilCP (Acropora millepora). In IOP Conference Series: Earth and Environmental
Science (Vol. 430, No. 1, p. 012014). IOP Publishing.
Mardis, E.R., 2017. DNA sequencing technologies: 2006–2016. Nature protocols, 12(2),
p.213.
Tafoya-Ramírez, M.D., Padilla-Vaca, F., Ramírez-Saldaña, A.P., Mora-Garduño, J.D.,
Rangel-Serrano, Á., Vargas-Maya, N.I., Herrera-Gutiérrez, L.J. and Franco, B., 2018.
Replacing standard reporters from molecular cloning plasmids with chromoproteins for
positive clone selection. Molecules, 23(6), p.1328.
Zhou, K.X., Langlois, L., Singh, A. and Prince, J., 2017. P33. Design and evaluation of an
Escherichia coli biomarker for indication of pH.

11BIOLOGY
For more explanation- You need to state the points you need more explanation (please
do not mention the headings such as results and discussion), kindly be specific so that
we can help you. Please be noted that it may charge additional word count on the basis
of time consumed in doing the additional work.