Bacterial Growth Rate Analysis: Wastewater Engineering Practical, MSc

This practical assignment for MSc Environmental Engineering students focuses on estimating design parameters from activated sludge growth experiments, specifically analyzing bacterial growth rates. Students will learn how to quantify total bacterial abundances using techniques like DNA extraction, qPCR, and flow cytometry. The assignment emphasizes the importance of understanding microbial growth and substrate utilization for designing biological wastewater treatment plants. The practical involves extracting and purifying DNA from activated sludge samples, preparing samples for qPCR, and using a flow cytometer for cell quantification. Safety protocols are strictly enforced due to the nature of the samples. The data collected by students from different time points and substrate concentrations will be pooled to complete a laboratory report, providing a comprehensive understanding of the experimental process and its application in environmental engineering. This assignment is a key component in understanding wastewater treatment plant design, emphasizing the practical application of theoretical concepts.

MSc Environmental Engineering, Wastewater Engineering
Practical: estimating design parameters from activated
sludge growth experiments.
Part 2. Bacterial growth rate.
It is important for Environmental Engineers to learn how microbial growth and substrate utilisation
parameters are derived and used in the design of biological wastewater treatment plants. This
practical teaches students how to quantify total bacterial abundances from activated sludge growth
experiments. Data from these experiments will be used to determine parameters used in the design
of an activated sludge wastewater treatment plant.
Furthermore an ability to quantify bacteria is essential in many aspects of environmental
engineering from counting faecal indicator organisms and pathogens for water quality to counting
bacteria to measure the efficacy of disinfection processes.
Safety: Samples contain small volumes of domestic wastewater or activated sludge originally
derived from a wastewater treatment plant. Care should be taken when handling such samples as
they can contain biological hazards that may pose a risk if not handled with care. Strictly no
drinking, eating or gum chewing in the lab. No mobile/cell phone use. Everybody is required to
wear a lab coat and eye protection (safety glasses) at all times. Be careful when handling samples
to eliminate or minimize spillage. Wash your hands before leaving the lab.
Emergency procedures:
General information
It is unlikely that accidental exposure to a pathogen will occur. Make sure that the lab rules above and
indicated in the Environmental Engineering Lab Safety Policy are followed.
After contact with skin
Where exposure involves skin contact, the area will be washed immediately with antibacterial soap and warm
water.
Remove all contaminated clothing immediately for washing.
Consult a physician.
After contact with eyes
Rinse cautiously with saline for several minutes. Remove contact lenses, if present and easy to do. Continue
rinsing.
Consult a physician.
After ingestion
Rinse mouth.
Consult a physician.
1

Background information
Bacteria are the catalysts of organic matter (measured as biochemical or chemical oxygen demand;
BOD or COD) and nutrient (e.g. ammonia and phosphorus) removal in secondary (biological)
wastewater treatment systems. The design of such systems (for example, their size and energy
demands) is derived from knowledge of the rates of growth and yields of bacterial groups that use
the organic matter or nutrients as an energy source.
Bacterial growth rates can be determined by measuring the abundance of bacteria over time when
growing on a substrate of a given initial concentration. Total bacterial abundance can be measured
in several ways; volatile suspended solids, optical density (when calibrated by other methods),
colony forming units of cultivable bacteria from plate counts, total direct microscopic counts or total
cell counts (with or without a dye), and flow cytometry. The latter two methods provide an accurate
assessment of total cell numbers.
The substrate utilisation rate and net specific growth rate are related in the following way:
Net yield= μ
q
where, μ is the net specific growth rate and q is the substrate utilisation rate.
While cultivation techniques have important uses, they are only able to quantify a proportion of the
total bacteria present in an environmental sample (as little as 0.1%). In the last 20 years ? there has
been a revolution in molecular techniques, using DNA - the hereditary material of life, to detect all
cellular organisms in a sample. For instance, fluorescent dyes that specifically bind to DNA can be
used to observe and count the cells that a sample contains (e.g. in Flow Cytometry) or enzymes can
be used to sensitively amplify specific DNA extracted (DNA extraction) from particular bacterial
species from as few as one cell, which can be counted against standards of known concentration
(e.g. quantitative polymerase chain reaction; qPCR).
Students will get the experience of using these latest techniques in this experiment.
A note on sampling- Sample collection is usually made into a sterile container (e.g. a screw-capped
centrifuge tube approx. 50 ml). For DNA extraction and qPCR, samples could be collected and kept
on ice for a few hours (during transit) prior to freezing at - 20°C in the laboratory. For flow
cytometry (FCM), total counts using epifluorescence microscopy, or fluorescence in situ
hybridisation; FISH), it is important to maintain the cell integrity of the organisms in the samples;
hence the samples cannot be frozen, since freeze-thawing results in cell lysis. Therefore, cells in the
sample are collected into absolute ethanol (1:1 v/v) or another fixative on-site, and kept on ice
during transit, prior to storage at - 20°C in the laboratory, and/or subsequent fixation in
paraformaldehyde (PFA) or gluteraldehyde soon afterwards. For convenience and safety reasons,
samples for the practical have been collected into ethanol so as to kill and ‘fix’ the cells in the
sample.
2

At the start of the practical:
Students to be given locker keys to put away their bags and jackets, need to wear lab coats, nitrile
gloves and safety glasses for the practical.
Tasks
1. Extract and purify DNA from one of the time points of the activated sludge growth
experiment to quantify the total bacteria using qPCR.
2. Disperse the cells from flocs and stain them for quantification using flow cytometry.
Each student will measure a different time-point of the growth rate experiment that was carried out
at different substrate concentrations. At the end of the week the pooled data from all of the
students will be provided to you to complete the laboratory practical report.
Organization
You will work in teams of two. Each member of the team will analyse a single sample from activated
sludge sample from different time points of an experiment carried out at a particular substrate
concentration.
Sample to collect before the practical:
Collect one DNA lysis tube containing cells that have previously been lysed to extract the DNA and
centrifuged to separate the DNA dissolved in the aqueous phase from the other cell components and
debris contained at the bottom of the tube and in the lower solvent layer.
Each student will also be provided with four flow cytometry vials and an Eppendorf tube containing
their sample from one time-point collected from a previously run the growth rate experiment. Make
a note of your sample numbers.
Equipment:
Microfuge (for centrifuging small Eppendorf tubes).
FastDNa Prep instrument (locally known at the Ribolyser)
Vortex
Heating block.
Sonication bath.
FACScan flow cytometer (Becton Dickinson, California).
CFX96 real-time PCR detection system (Bio-Rad) – positioned in another lab.
3

Task 1, DNA extraction, purification and qPCR:
In the last few years many commercially available products have become available which
incorporate the necessary techniques for cell lysis, DNA isolation and purification in one protocol
using kits, which are easy to use and quality assured. For this practical, students will use the MPBio
FastDNA Spin Kit for soil (Q-Biogene, MP Biomedicals, UK).
Those steps written in italics have previously been carried out by a member of staff.
Materials:
Volumetric pipettes with tips,
FastDNA for Soils lysis tubes containing sample,
Pre-aliquoted constituents of the FastDNA kit for Soils,
SPIN Filter and tube,
Catch tube,
2 x 2 mL sterile Eppendorf tubes,
200 μL sterile Eppendorf tubes
Task: Your task is to purify the DNA in your sample and prepare it for qPCR.
Each student will extract DNA from 1 wastewater sample (i.e. 1 DNA extract per student). Before
beginning DNA extraction, label one side of the appropriate tubes with the marker pen provided.
THIS SECTION HAS PREVIOUSLY BEEN CARRIED OUT BY A MEMBER OF STAFF
Sample Processing:
Add up to 250 μl of each sample to a separate Lysing Matrix E Tube.
Due to the vigorous motion of the Fastprep ® Instrument (or Hybaid Ribolyser), a significant pressure
build-up will occur in the tube. The sample and the Lysing Matrix should not exceed more than 7/8
of the tube in volume. Leaving space in the tube also improves the chance for better
homogenisation.
Lysis:
1. To each of the tubes, add 978 μl Sodium Phosphate Buffer and 122 μl MT buffer (a lysis
solution that incorporates the detergent sodium dodecyl sulphate (SDS)).
2. Secure tubes in the Ribolyser and process for 30 seconds at speed 6.5 (The instructor
will ensure this is done correctly and will start the equipment, and open the lid when it
has finished).
3. Centrifuge Lysing Matrix E Tubes at 13,000 g for 10 minutes.
4

Safety: FastDNA kits contain pre-dosed chemicals, some of which are harmful or irritants or are
flammable. Strictly no drinking, eating or gum chewing in the lab. No mobile/cell phone use.
Everybody is required to wear a lab coat and eye protection (safety glasses) at all times. Be careful
when handling samples to minimize spillage. Wash your hands before leaving the lab.
Emergency procedures:
General information
Eliminate all ignition sources. Absorb and/or contain spill with inert materials (e.g., sand, vermiculite). Then
place in appropriate container.
After inhalation
Move to fresh air.
If symptoms persist, call a physician.
After contact with skin
Wash off immediately with plenty of water for at least 15 minutes.
Consult a physician.
After contact with eyes
Rinse cautiously with saline for several minutes. Remove contact lenses, if present and easy to do. Continue
rinsing.
Immediately call a POISON CENTER/doctor.
After ingestion
Rinse mouth. Do NOT induce vomiting. Immediately call a POISON CENTER/doctor.
THIS SECTION IS TO BE CARRIED OUT BY THE STUDENTS
DNA purification
1. For each sample, transfer supernatant to a clean tube (2 ml pre-sterilised Eppendorf tube
provided in the beakers covered in foil). Add 250 μl PPS reagent and mix by inverting the
tube by hand 10 times.
2. Centrifuge at 14,000 g for 5 minutes to pellet the precipitate. Transfer 1 ml supernatant to a
clean 2 ml tube (pre-sterilised and provided in the beakers with foil). (Resuspend Binding
Matrix Suspension before use). Add 1 ml Binding Matrix Suspension ** to the supernatant.
** contains Guanidine Thiocyanate; use with caution**
3. Invert by hand for 2 minutes to allow binding of DNA to matrix. Place tube in a rack for 3
minutes to allow settling of silica matrix.
4. Remove 500 μl of supernatant being careful to avoid settled Binding Matrix. Discard
supernatant. Resuspend Binding Matrix in the remaining amount of supernatant. Repeat
steps 3 and 4.
5. Transfer approximately 600 μl of the mixture to a SPIN™ Filter with Catch Tube attached.
6. Centrifuge SPIN™ Filter containing mixture at 14,000 g for 1 minute. Empty the Catch Tube
and place the SPIN™ filter back on it.
7. Add the remaining binding matrix to the SPIN™ Filter and centrifuge at 14,000 g for 1
minute. Empty the Catch Tube and place the SPIN™ filter back on to it.
5

8. Add 500 μl SEWS-M (ethanol/salt to wash DNA) to the SPIN™ Filter and centrifuge at 14,000
g for 1 minute. Decant (throw away) flow-through and replace the SPIN™ Filter in the same
Catch Tube. Centrifuge at 14,000 g for 2 minutes to ‘dry’ the matrix of residual SEWS-M
wash solution.
9. Remove SPIN™ Filter and place in fresh kit-supplied Catch Tube. Air dry the SPIN™ Filter for
5 minutes at room temperature.
10. Add 50 μl DES (DNase / Pyrogen Free Water; to solubilise DNA), and finger flick to resuspend
the silica filter membrane for efficient elution of the DNA. Centrifuge at 14,000 g for 1
minute to transfer eluted DNA to Catch Tube. DNA is now ready to be used for PCR
amplification.
qPCR
The PCR amplifications will be carried out using SsoAdvanced Evergreen supermix (BioRad
Laboratories).
Two primers have been supplied which target the 16S rRNA gene region present in all bacteria.
These sequences are:
338F (20 bases)
ACTCCTACGGGAGGCAGCAG
1046R (19 bases)
CGACAGCCATGCANCACCT
Each student will set up two qPCR reactions, using their purified DNA extract as template. In
addition, each delegate will prepare a negative control sample without any DNA template (i.e.
sterile molecular grade water). Before beginning the PCR, label Eppendorf tubes with the marker
pen provided e.g. barcode used and DNA extract (name of the sample) or –ve control.
1. Label three tubes with the sample name and your initials
2. To each tube add, in the following order:
3. 6 μl of DNA extract
or
sterile molecular grade water (for the negative control).
6

Remember to change tips between tubes
4. 4ul of your Primer Mix (contains forward 338F primer reverse 1046R primer and
Molecular grade water in 1:1:2 ratio)
5. Add 10 μl of the SsoAdvanced Evergreen Supermix provided Try to avoid creating air
bubbles and dispersing the PCR mix on the walls of the tube.
6. Mix thoroughly by pipetting up and down.
A demonstrator will collect the tubes for pipetting into a 96-well plate with appropriate standards
before placing in the CFX96 real-time PCR detection system for amplification using the appropriate
programme as follows
1. 98 C for 3 mins (Hotstart and denaturation)
2. 98 C for 5 secs (denaturation)
3. 60 C for 10 sec + Plate Read (annealing and extension)
 GOTO 2, 39 more times
4. Melt curve 65 to 96 C, increment 0.5 C for 5 secs + Plate Read (analysis to
provide more quality control information on the qPCR reaction).
Task 2, Sample preparation and staining for flow cytometery:
The DNA in cells can be stained using fluorescent dyes that can be detected using light of an
appropriate wavelength that excites the dye, which will then emit fluorescence at a different longer
wavelength. Such cells fluoresce and can be detected and counted using a fluorescence microscope
or a flow cytometer whereby individual cells pass through a small aperture and detected. Bacteria in
flocs represent a problem for flow cytometry since they can block the aperture. Techniques are
therefore used to disperse the cells that constitute the floc prior to flow cytometry.
Materials:
Volumetric pipettes with tips,
Flow cytometry vials.
Task: Your task is to disperse the cells in your sample and stain them for flow cytometry.
1. Add 100 μl 10 mM sodium pyrophosphate to 900 μl of your previously fixed activated sludge
sample in a flow cytometry vial ensure the lid is fully pushed on.
2. Manually shake for 30 seconds.
3. Sonicate the vial for 3 minutes in the ultrasonication bath provided.
4. Label three flow cytometry vials with your sample number and the following dilutions 1/5;
1/50; 1/500.
7

5. Serially dilute your sample by taking 200 μl of your sample in to 800 μl of Tris-EDTA provided
in a flow cytometry vial.
6. Take 100 μl of the above dilution (in 5) and add in to 900 μl of Tris-EDTA in to a second
provided flow cytometry vial.
7. Take 100 μl of the above dilution (in 6) and add in to 900 μl of Tris-EDTA in to a third
provided flow cytometry vial.
8. Add 10 μl of SYTO9 (fluorescent DNA dye) to each dilution and incubate in the dark at 60 °C
for 15 minutes.
9. Take your sample to the flow cytometer where an instructor will demonstrate how it is
analysed.
8